Category: Life


Recently, I have been reading up on biology and I am fascinated by some of the recent developments and realizations in this field. So, I decided to write about it and here we are. Disclaimer : I am going to be deliberately handwaving in a few explanations so that most of the us can understand and appreciate the concepts. For those interested in the exact details, I have linked related references.

Have you ever asked the following questions to yourself?

  • Why do I have a distinct head, neck and a body? And why not wings so that I can fly?
  • Why do I have two legs, two hands, two eyes, two ears but only one nose?
  • Assuming the above two happen magically, still, why is it that each of my hands has exactly 5 fingers in the exact same order as others?
  • What influences the color of my hair, skin, eyes etc.?
  • How can I see, smell, hear and speak like every other person? Why not have a couple of antennas and smell through them?

After all, all of us humans come from a single unique cell created in our mom’s womb and so there should be no reason for us to look similar. When questions like those mentioned above come up during conversations or during solitary contemplations during my bus travels, I usually justify them with universal answers like “God” or “nature” or “hey, its simple evolution! Nothing fancy there!”. Then the following fundamental questions ensue,

  • What is evolution?
  • If evolution occurs somewhere between parents and offsprings, how does it happen exactly, when does it happen and where exactly in the human body? (Well, it has to be somewhere in the human body, right?)

Now that I have a little bit of understanding on the underlying biology, I am starting to appreciate these seemingly subtle things which constantly evaded my attention because I was, you know, busy. The answer to all the above questions is not centralized to a metaphorical “heart” or any other single location in the human body. The answer lies in every cell in our body. Its the deoxyribonucleic acid aka DNA. Lets dive in!

Human Cell –> Nucleus –> Chromosomes –> DNA –> Genes

A recent study from University of Bologna tells us that the total number of cells in the human body is around 3.7 x 10^13. Each of these cells looks like the one shown below (top left part). There are exceptions like red blood cells, which don’t need/have a nucleus since their main role is just transportation of oxygen.

Where exactly is our DNA?

Where exactly is the DNA in human cell?

Each of the trillions of human cells in your body has a central nucleus, which in turn has a ridiculously convoluted chromatin sphagetti, which contains 23 pairs of chromosomes. Why is it a pair? In each pair, one is from your dad and the other one is from your mom! I see that you want to call your parents already.

Now, each of the 46 chromosomes is made up of tightly wound double helical strands of nucleotides called DNA. The two strands are connected by a series of “base pairs” which are composed of A, G, C or T. If we unwind all the DNA strands from all the 46 chromosomes from a single cell in your body, it will come up to 3 kms (reference). If we stretch out such a strand, we will have 6.4 billion base pairs (AT, GC). And a gene is nothing but a logical grouping of these base pairs.

Genes - logical segments in DNA

Genes – logical segments in DNA (Image Courtesy : Plant and Soil Sciences eLibrary)

Gene sequence –> Human Traits

What is so special about a gene is that each gene corresponds to one or more of our traits (like height, obesity, hair color, ear wax etc.). Sometimes a group of genes can affect a trait. Based on the number of genes that affect a trait, each of our human traits is categorized as polygenic, pleiotropic or mendelian. Next, to better understand this concept, lets take up an ordinary human trait which we all hold. For instance, I am less sensitive to smell as compared to my peers. This is a mendelian trait i.e. It is influenced by a single gene called OR11H7P which is present in chromosome 14. Zooming in further, the sequence of bases in OR11H7P in chromosome 14 (reference) is supposed to look like the following :

ATGAATAACTCACAGATATCTACTGTGACGCAGTTTGTGTTGTTGGGGTTTCCTGGTCCC
TGGAAAATTCAGATCATCTTTTTCTCAATGATTTTGTTGGTCTACATCTTCACTCTGACT
GGGAATATGGCCATCATCTGTGCAGTGAGGTGGGACCATCGACTCCATACCCCTATGTAC
GTGCTCCTAGCCAACTTCTCCTTCCTAGAGATCTGGTATGTGACCTGCACAGTCCCCAAC
ATGCTGGTAAATTTTTTCTCCAAAACTAAGACCATATCATTCTCTGGATGTTTCACTCAG
TTCCACTTCTTCTTTTCCCTGGGCACAACTGAATGCTTCTTCCTCTGTGTCATGGCTTAT
GATCGGTACCTGGCCATCTGCCACCCACTGCACTATCCCTCCATTATGACTGGCCAGCTC
TGTGGCATCTTGGTGTCTCTTTGTTGGCTCATTGGTTTCCTTGGACATTCAATTTCCATT
TTCTTCATTTTTCAACTACCTTTCTGTGGTCCCAACATCATTGATCATTTTCTGTGTGAT
GTAGACCCACTGATGGCATTGTCCTCTGCCCCTACTCACATCATAGGGCATGTGTTCCAT
TCTGTGAGCTCTCTTTTCATCAACCTCACCATGGTGTACATCCTTGGGTCCTATACCTTG
GTGCTCAGAACTGTGCTTTAGGTTCCTTCTTCAGCTGGATGGCAAAAGGCCATCTCTACC
TGTGGGTCACACTTGGTTGTTGTGTCTCTGTTCTATGGAGCCATAATGCTGATGTATGTG
AGTCCCACACCTGGCAACTCAGTTGCTATGCATAAGCTCATCACACTGATATATTCTGTG
GTAACACCTGTCTTAAACCCCCTCATCTACAGCCTACGCAACAAGGACATGAAATATGCC
CTCCATCATGTCTTCTGTGGAATGAGAATTATCCAGAGATCA

The above sequence is perfect and would have made me super sensitive to smell. However, thanks to gene variations (or more specifically SNPs or CNVs) that came through my mom or dad, my ability to sense smell has gone down. But how?

Diving deeper : From gene sequence to sense of smell 

The next obvious question is “how do you say that the above gene sequence of OR11H7P affects the way we smell”?

As far as any protein/hormone secretion is concerned, it happens in two steps within a human cell. Firstly, transcription causes the gene from inside the nucleus to be encoded on a messenger RNA (mRNA), which is shipped to organelles inside the same cell called ribosomes (which are generally sticking on to another organelle called rough endoplasmic reticulum). The ribosomes are like the binding spots for mRNAs and things called transfer RNAs (tRNAs). tRNAs provide the building blocks for all proteins. As a result of this binding called translation, the gene sequence encoded in mRNA is translated to long polypeptide chains which are in turn sent to another organelle called the Golgi Apparatus which ultimately produces the hormone/protein required for that corresponding part of the body to perform its task. E.g. In case of the sense of smell, the cells are the olfactory cells in our nose and the proteins are called olfactory receptors which do the actual sensing of smell.

Now that we have understood the impact of one gene named OR11H7P on our body, we should also know that the Human Genome Project put the total number of genes to somewhere around 20,000 to 25,000. So imagine how every gene could affect each part of your body. Then, think of the complex machinery and the billions of incredibly coherent and consistent operations happening right now in your body. Isn’t that amazing! Thus the DNA is like the governing body for the human cell. It instructs every cell what to produce, how to produce, when to produce, what to grow, how to grow etc.

For the complete set of human genes to human traits mapping, remember that there are 23 pairs or chromosomes in the human cell and read the compilation at Eupedia. For a more thorough understanding on this subject, read up on Single Nucleotide Polymorphisms (SNP), Copy Number Variations (CNVs) and the Genome Wide Association Studies (GWAS). That should answer the first set of questions we had.

Now that we have a better sense of how exactly we are what we are in terms of size, shape, color, behavior etc. it should be obvious that the evolution is merely selection of better (or more suitable genes) when the offspring is created. One of the major factors that helps evolution lies in a process called meiosis which is responsible for generation of sex cells from oocytes and spermatocytes. There is a particular step called “homologous recombination” after the “crossing-over” step where the parental genes unlink and recombine in various combinations. This means that each sex cell would have a different blueprint of a human being. So we look like what we are right now because of the male sex cell and the female sex cell that combined to create the original zygote. A different combination would have led to a different human being with different selection of traits. As simple as that. Besides this, there is also the effect of human migration across countries and continents on the mix of genetic composition of people in different places. And this answers the second set of questions we had.

Future directions :

Firstly, research. More research.

Interestingly, we might tend to think that all the biological processes could be studied easily by observing every biological process under a super-powerful microscope. But for some reason, it is not that simple. For example, the effect of a protein called dynein on the most fundamental cell division process called mitosis was discovered as recently as February 2012 by Tomomi Kiyomitsu from MIT (reference).  This is 134 years after Walther Fleming originally observed mitosis. Given the nascency of the field of genetics research and the enabling technologies around it, there is no doubt that we have a long way to go in terms of discoveries and products that leverage them.

Secondly, technologies to derive useful inferences from DNA sequences.

We know that the most common type of diabetes, i.e. Type 2 diabetes arises from the fact that human cells cannot respond properly to a pancreatic secretion called insulin. One of the genes that influences Type 2 diabetes is TCF7L2 in chromosome 10 which affects insulin secretion and glucose production. This means that just by looking at our DNA, we can tell if we have a susceptibility to diabetes and similar diseases in future. That exactly is the goal of DNA sequencing. The largest effort on DNA sequencing was the Human Genome Project which ended in 2003 at a cost of $2 billion dollars. Then three startups namely 23AndMe, Navigenics and deCODEme initiated the personal genomics revolution which allowed individuals to get their genome sequenced and helped cut down the cost of DNA sequencing. Besides companies, several individual innovators from legends like Craig Venter to the then 23 year-old student Eugene Chan contributed towards the algorithms and procedures to cut down the cost of DNA sequencing which has ultimately led us to where we are. Once we get our DNA sequenced by any personal genomics company there are services like interpretome.com, that can get those files as input and provide medical inferences which are extremely useful. Our genomes are all set to become yet another major component in our medical records, just like height, weight and blood pressure.

Back in 2008, one of the billionaire entrepreneurs named Sergey Brin (a cofounder of Google) got his DNA sequenced and realized that he had a good chance of being affected by Parkinson’s disease and since then he had started following suitable counter measures for avoiding the same. He had written about this in his blog here.

"This leaves me in a rather unique position. I know early in my life something I am substantially predisposed to. I now have the opportunity to adjust my life to reduce those odds (e.g. there is evidence that exercise may be protective against Parkinson's). I also have the opportunity to perform and support research into this disease long before it may affect me. And, regardless of my own health it can help my family members as well as others.

I feel fortunate to be in this position. Until the fountain of youth is discovered, all of us will have some conditions in our old age only we don't know what they will be. I have a better guess than almost anyone else for what ills may be mine -- and I have decades to prepare for it."

Trivia : One of the cofounders of the personal genomics startup 23AndMe, Anne Wojcicki, was Brin’s wife.

To understand more about the different forces that led to the genomics revolution, I would suggest you to read “The $1000 Genome” by Dr. Kevin Davies. This book beautifully sketches the various people and the companies that initiated this revolution and brought down the cost of sequencing by a huge margin. The cost to get an individual’s genome started from $999 dollars in 2007 to $399 in 2008 to $99 dollars right now (23AndMe). So, get your genome sequenced and know about yourself, literally. I have ordered a kit from 23AndMe and I am super excited about it. A revolution similar to the 1980’s PC revolution has happened silently (atleast to me!) and its high time we embrace this paradigm shift and appreciate its implications to take human civilization to the next level. Also, this is leading us to a whole new era of personalized medicine, where a drug is focused on per disease per person instead of just per disease.

Thanks to my friends at UCSD for inspiring me to read up on biology. Thanks to Hank Green for his wonderful biology lectures. And thanks to all the biologists for providing us better understanding about ourselves every passing day! Keep rocking, folks!

Let me answer the first question that pops up in your head.
Question   : Where the hell have you been the last one year?
Answer     :  I was lost rediscovering myself. Cryptic huh? I can assure you, once you reach the end of this blog post, you will find the meaning to that answer.

From my previous blog posts, you already know that I was an ordinary adolescent ceaselessly rambling about a zillion passions I wished to pursue. Trust me, the uncertainty continues even through my early 20’s. Despite the uncertainty, in due course of time, I have experienced the nature of work in two tech giants of varied origins and goals – Cognizant, a technology services company and eBay, a product company. This blog post summarizes what I have learnt in my brief stint in the corporate world.

Firstly, let me answer the question “Why did I choose eBay?”. To be honest, I did not choose eBay. I was not that laser-focused pro-active hyper-determined foresighted teenager you would find in college. When I sat for the eBay interview, I had absolutely no idea what I wanted to do in my life. My placement officer said its a dream offer. DREAM – that’s the word that pushed me. If getting into eBay is the dream of 500 odd students in my own campus, then its definitely worth a shot. So I attended the recruitment drive and I was in. And I must say that it was one of the best decisions I had taken then.

What followed after getting into the corporate life is what I would like to highlight in this blog post. Just bullet points (Though each point deserves a separate blog post on its own). Here we go.

Lesson 1 : “Its OK” to make mistakes

The initial tasks I was assigned as a fresher were dashboard/reporting tasks – to define in a nutshell, the kind of tasks that won’t bring ebay.com down if I mess up. I totally understood the rationale and I loved the work and learnt a hell lot about web technologies and project management in general. In a few days, I was fortunate enough to lay my hands on some core frameworks in eBay platform. One fine day, my very first change to eBay’s web service framework was about to go live and I made a tweeny blunder in the development to release process. Once I realized it, I was horrified. I thought there will be an outage. Consequently, eBay might lose a good number of customers and I am fired for sure. However, my manager comforted me with the words “Its OK to make mistakes in the initial stages”. That was an invaluable advice that came at the right time. I came back home thinking about it and eventually it seeped in deep into my character. In the days that followed, it helped me to learn things much faster and get myself up to speed with the other developers in my team. With a bit of self-retrospection, it occurred to me that I had feared to make mistakes my entire life. I did not cultivate that much-needed courage. Why? Interestingly, it has its roots in my primary education. I had been a bright student right from my primary school. Whenever I gave an exam, I made sure I don’t make a single mistake. Because, if I do, the chain of events would be like – make mistakes in exam – red ink marks on answer sheet – “You failed to score high marks” – teacher thrashes me – next exam – I don’t want to make mistakes because I don’t to “fail” and get beaten up. And sadly, I have been through this for over 15 years of my school life. So, my brain had taught itself to equate making mistakes to failure and punishment.

Now, I am better. I learnt that asking forgiveness for a mistake is easier and consumes lesser time than asking permission before doing anything new.

Lesson 2 : There is no box!

My team members love having healthy arguments and discussions. The topics ranged from machine learning to the pronunciation of the word “air”. During one of the technical discussions I had with my teammate, he mentioned that my thoughts were outside the box. That was the first time I heard someone use that phrase –  “outside the box”. It directly means ‘thinking from a new perspective’. But I was haunted with a different question – what the hell is this “box” anyway? Why do you visualize “perspectives” to a “box”. After running this question over and over again inside my head, I eventually realized that the box directly meant ossification that happens in the corporate world. You can easily tell engineers apart with reference to this simple criteria – if they are ready to challenge the status quo and innovate, or they just settle with what is just “there and working”.

What creates this difference? As time progresses, whenever we find that a problem is solved with a sub-optimal solution, say X, a few among us ask “why X?”, then, with a few email exchanges, they get the justification on why the solution is sub-optimal and live with it. They forget the next step – asking the question “why not Y?” where Y is the optimum solution. Keeping this mentality of “Why not?” alive will ensure we don’t confine ourselves in this virtual “box” of perspectives. This attitude alone can motivate us to get the big picture and innovate consistently. So we should remember – ask why, at the same time, think why not.

Lesson 3 : Scoping – Breaking a top level idea into achievable chunks, supported by a well-defined timeline

Scoping is one place where I have been failing miserably, but it went unnoticed since most of the tasks in school and college did not expect me to give a timeline for completion. In corporate life, since the projects in my team followed SCRUM model of development, I had numerous opportunities to test myself in scoping. Then, I realized that my timelines for a task X are generally based on two assumptions :

  1. I was the only person alive in office.
  2. X was going to be the only task I was going to work on. There would be no interruptions.

A 5-month experience in SCRUM model helped me to greatly improve upon my scoping skills which is a very important asset to any software engineer. Now, given a task X, I can comfortably break it down into a set of achievable chunks with a clearly defined timeline accommodating all kinds of possible interruptions. If not the best, I can definitely do it much better than what I would have done a year ago.

Lesson 4 : Importance of evaluating myself regularly

It is very important to evaluate ourselves against our end goals, regularly and religiously. In corporate life, in the constant stream of external noise that comes in the form of email, meetings and phone calls, we might end up in a vicious illusion of “important stuff”, clearly losing sight of our goals. We should keep asking ourselves the question “Am I inching towards my end goal with each passing day?” If the answer to this question is “No” for a considerable number of days, then its high time we take a drastic step to reset our priorities and get back on track. For this to happen, its very important that we set up some fixed chunk of time each week, where we go over our long term goals in corporate life and cross-check our current activities with the career trajectory we have projected for ourselves. In my case, I generally go missing from my desk from 3 pm to 4 pm every friday 😉 That is my self-evaluation time.  I stuck to the schedule religiously and it really helped me a lot.

I combine this weekly schedule with occasional micro-retirements of 2-3 days. During micro-retirements, I go home, lie on my bed and stare at the ceiling. Nothing else. It helps me to completely stay away from the external noise, allowing my inner voice to take control. Sounds strange and impossible to do. But once you do it, you will like it.

Lesson 5 : Importance and urgency are two different things

While at office, I used to compete with my team lead in literally everything work-related – requirements gathering, planning, scheduling, coding, usage of cutting-edge technologies, execution time, speed in which emails are replied.. well, you name it. Very soon, I realized that I was not as productive as he was. Apparently, I put in an equal effort (often much more) than he does, but still my productivity was no match to what he gets done in the same time. I initially doubted my execution skills, but later understood that the actual problem was in a different phase – Prioritization. It dawned upon me that I was mixing up urgency and importance. Most of the times, tasks come in the form of emails. In that context, when someone starts sending reminders on top of an actionable email, the corresponding task automagically climbs up my priority ladder. So, whenever I get a bunch of actionable emails, I prioritized them according to urgency ALONE, and that was a mistake. As usual, I was experimenting with different ways of prioritizing tasks. On a nice friday morning, I read about the famous Covey’s Time Management Grid. And (many would agree) fridays are the best days for experiments. So i tried it out. The beauty of Covey’s system is that its so simple that I started applying it to my experiments, and found visible results immediately. I am still evolving it to suit my needs. With this, I make sure that I am not just busy, but productive.

Additional point : I combine the time management grid with a rule called the 2-minute rule proposed by David Allen. It says “If you determine an action can be done in two minutes, you actually should do it right then because it’ll take longer to organize it and review it than it would be to actually finish it the first time you notice it.”. It helped me a lot. If you had not tried it earlier, I’d suggest that you give it a shot.

Lesson 6 : Time Management

Firstly, let me talk on buying time. The most lucrative source of time is meetings. Frankly 80% of the meetings can be eliminated by converting them to emails (Yes, I love Pareto’s 80-20 rule). Its true mainly because most of the meetings don’t have a strong discussion point. This leads to discussion on tangential topics without really coming to the problem under investigation.

I was able to convert a few meetings into emails which bought a good amount of time in office. There is a simple communication preference I follow – handle most of the queries through email, next step is phone call, finally resort to setting up meetings. Luckily, I did not have too many meetings. But, as anyone goes up the organizational hierarchy, there will be a need to present oneself and add value in multiple meetings. Having a clear communication preference will help then.

Secondly, its about saving time. I learnt that I work well when I set really hard deadlines to myself. If a task can be completed in 2 hours, I give it no more than 3 hours (including interruptions and coffee breaks). Because, I have a feeling that the task will swell in perceived importance and complexity in relation to the time allotted for its completion. As Parkinson famously stated in a 1955 edition of The Economist, “Work expands so as to fill the time available for its completion”. If we don’t limit it, it will limit our overall productivity and lay its hands on our peaceful work-life balance!

Thats all folks! Having spent an invaluable one year in the industry, I am taking these well learnt lessons to my next step in life – Masters in Computer Science at the University of California, San Diego.

Cheers!

Way to GSoC!

If there is one thing, which is a dream goal for any college student who loves to code, that would be GSoC (pronounced ‘jee-sock’). Well, what is this GSoC? Directly from the horse’s mouth,

Google Summer of Code is a global program that offers post-secondary student developers ages 18 and older stipends to write code for various open source software projects.”

Long story short – Students willing to participate should first go through the list of selected organizations in GSoC -> Choose an organisation -> Choose a project -> Start discussing your proposal with the mentors and improve it -> Make a proposal and submit it through Google Melange. If you are selected, you make history (along with 5000 USDs in your bank account :P).

GSoC 2012

I chose Umit as my organisation. Why? Take a look at their list of projects and you would understand the reason. Among all these projects, the relatively new “OpenMonitor” project was my favourite. I loved their idea. As it sounds, its a Monitor for the Open Internet. It keeps track of all the connections on the Internet and has the ability to trace back the reason of a network blockage or blackout. Simply put, it frames a nervous system of the Internet by implementing a peer-peer topology of nodes scattered around the globe. Thats totally awesome. I really wanted to be part of this wonderful project. When? It was last year (2011) May. I worked with Luis, who is a mentor at Umit. He was really really helpful. He guided me right from scratch and helped me out at every stage. I hacked around a bit on Umit Network Scanner, Packet Manipulator and OpenMonitor then. I even made a talk on Umit Network Scanner at Pycon India 2011.

Then came the news of GSoC 2012. And Umit made its way to the selected organisations list this time too! My joy knew no bounds to know that I had the chance to work on my favourite project as part of the legendary Google Summer of Code 😀

I studied the code of Desktop Agent and Mobile Agent of OpenMonitor and I found that the Interpeer Routing was in a prototype-like stage and it really needed to be tweaked up for further enhancements to happen. Thus I started discussing the problem with Zubair, Luis and Adriano and finally settled with implementing a Kademlia based P2P implementation for the inter-peer communication among the desktop agents, mobile agents and the aggregator. We initially planned to make our own implementation from scratch in Python, but later planned to use C++ Kademlia libraries and writing wrappers in Python and Java.

And after all the discussions, I was able to fine tune my project proposal and submit my proposal.

The list of accepted proposals were out by GMT 1900 hours yesterday on the Google melange site and I was glad to see my name on the list. Now, I have a chance to work in one of the coolest projects in the open source world as part of the Google Summer of Code. I am really proud and happy to be at this place.

Special thanks to Dorai Thodla, Karthik Subramaniam, Madhumitha Vishwanathan, Yuvaraj Pandian and all the members of ChennaiGeeks and ILUGC communities in Chennai for exposing me to such excellent opportunities which until last year I hadn’t heard of.

Cheers! 🙂

This post is about the wonderful experience I had with the Cognizant family in the first edition of “XPERIENCE COGNIZANT”. I wish each one of you experience the same!

So, how to make your way to be part of the 3-day festival? Open up your mind buddy, let me drop in some knowledge 😉

Around the beginning of August 2011, I got the news about the first edition of “Experience Cognizant”. Initially I thought it was an usual mundane meeting wherein people at Cognizant say Cognizant is this and that and show some steeply raising graphs and charts of their profits. (Trust me, it was not so. The experience was OUT OF THE WORLD! )Students who were interested were asked to fill a terse nomination form which had questions like “Name” “Department” etc. and the second half of the page was left blank to fill in any specific achievements we would like to brag about 😛 After a couple of weeks, we got information through our placement cell that two students were selected as the Cognizant Brand Ambassadors from my college (SSN College of Engineering). Well! It was me and my college senior Nandhitha. Yayy! What next? The only thing we knew was that we should assemble at Cognizant Campus in MEPZ Chennai by 9.00 am on August 26, 2011 and we are gonna stay there for the next three days. Thats it. So I packed up stuff for the next three days and set off for XPC’11

The Cognizant Campus Ambassadors from the select 60 colleges from all over India were invited to participate in the 3-day conclave ‘Xperience Cognizant’. We were around 92 students in total. The purpose of this conclave was to create awareness among the student body about the work ethics of Cognizant and the future of technology as envisioned by Cognizant Technology Solutions. Lets call it a platform provided for the ambassadors to meet and interact with the senior level management at Cognizant and get to know how things work there. It was fantastic to meet the best minds from far corners of India pooled into a single place. We were excited to know what Cognizant had for us for the next three days. Here is a brief note on the 3-day festival.

Day 1:
Satish Jeyaraman who heads Talent Acquisition Team of Human Resource Department gave a presentation on Volatility in the technological world. He was a silent and humble person with versatile knowledge on the corporate world. He explained how Cognizant survived the legendary “Recession” disease. This was followed by a group activity where the ambassadors had to do role-play and collage art work on the topic related to placements. The creativity and acting skills of the students baffled me! There was another session at SIPCOT in Chennai by Ramachandran ,the Head of India for Campus Training Operations, about the training process that takes place at Cognizant. I must say that Cognizant is a mini-college. State-of-the-art technology with brilliant faculty. What else do you need for learning? Btw, it was the end of day. We went back to our rooms in the exquisite FORTUNE hotel standing elegant on the OMR road, Chennai. Owing to the continuous traveling that day, I slept like a baby as soon as I entered the room.

Day 2:
The ex-CEO of Cognizant Mr. Lakshmi Narayanan gave a short presentation and answered all the questions posed to him. I wanted to take a video of his talk. But sticking out my phone amidst such a refined set of audience would make me look dumb #PatheticMe :-P. Then, Raj Bala, Chief Technology Officer of Cognizant took a session on upcoming trends in IT. He also explained about all the research initiatives that Cognizant was pioneering. I was really interested on Cognizant’s work on Cloud Computing and Mobile technologies. Until then I was thinking Cognizant was all about C#, .NET and Java. But I was completely wrong. Their scope is far far beyond what I had initially surmised. Then suddenly we had a quiz competition rolling in! They called it ‘AWE’ General Quiz. Each college forms a team. Nandhitha and I cracked the prelims and won Second Prize in the finals. Then there was a premilinary round on Technical quiz wherein we had questions on C and C++. Being a Computer Science student, I found it really simple and finished it off soon. This was followed with an evening of cultural activities where the employees of Cognizant performed. I even saw few of my college seniors there.

The Day-2 night is unforgettable. Each and every incident which happened then is still so vivid in my head. Now before you jump into conclusions, let me say that your guess is wrong (Bad bad mind, no doughnuts for you! :P) That night, all the Tamil speaking people stayed up in a single room and we were chatting till 3 or 4 in the night (I don’t remember the time. But it was late). We had this “Truth or Dare” game and then some beautiful love stories getting revealed. It was nice meeting new people.

Day 3:
The day began with the Prize distribution ceremony. You have no idea how many prizes Nandhitha and I grabbed then! 😀 Let me list them.
1. General Quiz: 2nd Place – Won 12.1 MP Sony Cybershot Digicams
2. Technical Quiz: 2nd Place – Won iPods
SSN College emerged as the overall winners and we Campus Ambassadors won Acer Laptops and the title “Grand Brand Ambassadors”. And after that there was no talks, no quizzes or no Cognizantism. It was a special screening of the movie ‘Final Destination 5’ arranged at Mayajaal! It was awesome.

tl;dr : In a nutshell this program was mainly aimed at promoting the brand value of Cognizant so that more students will be interested in being a part of the Cognizant family. It was a wonderful learning-cum-fun experience meeting and sharing ideas with the best brains from across the country. Experience of a lifetime. (And I must say that Cognizant is one of the best workplaces I have seen. If you are a tech news follower, then you’d have noticed that Cognizant CEO D’Souza is one of the titans who’d define India in 2012)

Xperience Cognizant - 2011

And here is the interesting part! Cognizant is collecting nominations for the next version of “Xperience Cognizant”. Contact your college placement cell for more information. All the best guys! Don’t miss it..
Cheers! 🙂