Category: C. Contemplations


Recently, I have been reading up on biology and I am fascinated by some of the recent developments and realizations in this field. So, I decided to write about it and here we are. Disclaimer : I am going to be deliberately handwaving in a few explanations so that most of the us can understand and appreciate the concepts. For those interested in the exact details, I have linked related references.

Have you ever asked the following questions to yourself?

  • Why do I have a distinct head, neck and a body? And why not wings so that I can fly?
  • Why do I have two legs, two hands, two eyes, two ears but only one nose?
  • Assuming the above two happen magically, still, why is it that each of my hands has exactly 5 fingers in the exact same order as others?
  • What influences the color of my hair, skin, eyes etc.?
  • How can I see, smell, hear and speak like every other person? Why not have a couple of antennas and smell through them?

After all, all of us humans come from a single unique cell created in our mom’s womb and so there should be no reason for us to look similar. When questions like those mentioned above come up during conversations or during solitary contemplations during my bus travels, I usually justify them with universal answers like “God” or “nature” or “hey, its simple evolution! Nothing fancy there!”. Then the following fundamental questions ensue,

  • What is evolution?
  • If evolution occurs somewhere between parents and offsprings, how does it happen exactly, when does it happen and where exactly in the human body? (Well, it has to be somewhere in the human body, right?)

Now that I have a little bit of understanding on the underlying biology, I am starting to appreciate these seemingly subtle things which constantly evaded my attention because I was, you know, busy. The answer to all the above questions is not centralized to a metaphorical “heart” or any other single location in the human body. The answer lies in every cell in our body. Its the deoxyribonucleic acid aka DNA. Lets dive in!

Human Cell –> Nucleus –> Chromosomes –> DNA –> Genes

A recent study from University of Bologna tells us that the total number of cells in the human body is around 3.7 x 10^13. Each of these cells looks like the one shown below (top left part). There are exceptions like red blood cells, which don’t need/have a nucleus since their main role is just transportation of oxygen.

Where exactly is our DNA?

Where exactly is the DNA in human cell?

Each of the trillions of human cells in your body has a central nucleus, which in turn has a ridiculously convoluted chromatin sphagetti, which contains 23 pairs of chromosomes. Why is it a pair? In each pair, one is from your dad and the other one is from your mom! I see that you want to call your parents already.

Now, each of the 46 chromosomes is made up of tightly wound double helical strands of nucleotides called DNA. The two strands are connected by a series of “base pairs” which are composed of A, G, C or T. If we unwind all the DNA strands from all the 46 chromosomes from a single cell in your body, it will come up to 3 kms (reference). If we stretch out such a strand, we will have 6.4 billion base pairs (AT, GC). And a gene is nothing but a logical grouping of these base pairs.

Genes - logical segments in DNA

Genes – logical segments in DNA (Image Courtesy : Plant and Soil Sciences eLibrary)

Gene sequence –> Human Traits

What is so special about a gene is that each gene corresponds to one or more of our traits (like height, obesity, hair color, ear wax etc.). Sometimes a group of genes can affect a trait. Based on the number of genes that affect a trait, each of our human traits is categorized as polygenic, pleiotropic or mendelian. Next, to better understand this concept, lets take up an ordinary human trait which we all hold. For instance, I am less sensitive to smell as compared to my peers. This is a mendelian trait i.e. It is influenced by a single gene called OR11H7P which is present in chromosome 14. Zooming in further, the sequence of bases in OR11H7P in chromosome 14 (reference) is supposed to look like the following :

ATGAATAACTCACAGATATCTACTGTGACGCAGTTTGTGTTGTTGGGGTTTCCTGGTCCC
TGGAAAATTCAGATCATCTTTTTCTCAATGATTTTGTTGGTCTACATCTTCACTCTGACT
GGGAATATGGCCATCATCTGTGCAGTGAGGTGGGACCATCGACTCCATACCCCTATGTAC
GTGCTCCTAGCCAACTTCTCCTTCCTAGAGATCTGGTATGTGACCTGCACAGTCCCCAAC
ATGCTGGTAAATTTTTTCTCCAAAACTAAGACCATATCATTCTCTGGATGTTTCACTCAG
TTCCACTTCTTCTTTTCCCTGGGCACAACTGAATGCTTCTTCCTCTGTGTCATGGCTTAT
GATCGGTACCTGGCCATCTGCCACCCACTGCACTATCCCTCCATTATGACTGGCCAGCTC
TGTGGCATCTTGGTGTCTCTTTGTTGGCTCATTGGTTTCCTTGGACATTCAATTTCCATT
TTCTTCATTTTTCAACTACCTTTCTGTGGTCCCAACATCATTGATCATTTTCTGTGTGAT
GTAGACCCACTGATGGCATTGTCCTCTGCCCCTACTCACATCATAGGGCATGTGTTCCAT
TCTGTGAGCTCTCTTTTCATCAACCTCACCATGGTGTACATCCTTGGGTCCTATACCTTG
GTGCTCAGAACTGTGCTTTAGGTTCCTTCTTCAGCTGGATGGCAAAAGGCCATCTCTACC
TGTGGGTCACACTTGGTTGTTGTGTCTCTGTTCTATGGAGCCATAATGCTGATGTATGTG
AGTCCCACACCTGGCAACTCAGTTGCTATGCATAAGCTCATCACACTGATATATTCTGTG
GTAACACCTGTCTTAAACCCCCTCATCTACAGCCTACGCAACAAGGACATGAAATATGCC
CTCCATCATGTCTTCTGTGGAATGAGAATTATCCAGAGATCA

The above sequence is perfect and would have made me super sensitive to smell. However, thanks to gene variations (or more specifically SNPs or CNVs) that came through my mom or dad, my ability to sense smell has gone down. But how?

Diving deeper : From gene sequence to sense of smell 

The next obvious question is “how do you say that the above gene sequence of OR11H7P affects the way we smell”?

As far as any protein/hormone secretion is concerned, it happens in two steps within a human cell. Firstly, transcription causes the gene from inside the nucleus to be encoded on a messenger RNA (mRNA), which is shipped to organelles inside the same cell called ribosomes (which are generally sticking on to another organelle called rough endoplasmic reticulum). The ribosomes are like the binding spots for mRNAs and things called transfer RNAs (tRNAs). tRNAs provide the building blocks for all proteins. As a result of this binding called translation, the gene sequence encoded in mRNA is translated to long polypeptide chains which are in turn sent to another organelle called the Golgi Apparatus which ultimately produces the hormone/protein required for that corresponding part of the body to perform its task. E.g. In case of the sense of smell, the cells are the olfactory cells in our nose and the proteins are called olfactory receptors which do the actual sensing of smell.

Now that we have understood the impact of one gene named OR11H7P on our body, we should also know that the Human Genome Project put the total number of genes to somewhere around 20,000 to 25,000. So imagine how every gene could affect each part of your body. Then, think of the complex machinery and the billions of incredibly coherent and consistent operations happening right now in your body. Isn’t that amazing! Thus the DNA is like the governing body for the human cell. It instructs every cell what to produce, how to produce, when to produce, what to grow, how to grow etc.

For the complete set of human genes to human traits mapping, remember that there are 23 pairs or chromosomes in the human cell and read the compilation at Eupedia. For a more thorough understanding on this subject, read up on Single Nucleotide Polymorphisms (SNP), Copy Number Variations (CNVs) and the Genome Wide Association Studies (GWAS). That should answer the first set of questions we had.

Now that we have a better sense of how exactly we are what we are in terms of size, shape, color, behavior etc. it should be obvious that the evolution is merely selection of better (or more suitable genes) when the offspring is created. One of the major factors that helps evolution lies in a process called meiosis which is responsible for generation of sex cells from oocytes and spermatocytes. There is a particular step called “homologous recombination” after the “crossing-over” step where the parental genes unlink and recombine in various combinations. This means that each sex cell would have a different blueprint of a human being. So we look like what we are right now because of the male sex cell and the female sex cell that combined to create the original zygote. A different combination would have led to a different human being with different selection of traits. As simple as that. Besides this, there is also the effect of human migration across countries and continents on the mix of genetic composition of people in different places. And this answers the second set of questions we had.

Future directions :

Firstly, research. More research.

Interestingly, we might tend to think that all the biological processes could be studied easily by observing every biological process under a super-powerful microscope. But for some reason, it is not that simple. For example, the effect of a protein called dynein on the most fundamental cell division process called mitosis was discovered as recently as February 2012 by Tomomi Kiyomitsu from MIT (reference).  This is 134 years after Walther Fleming originally observed mitosis. Given the nascency of the field of genetics research and the enabling technologies around it, there is no doubt that we have a long way to go in terms of discoveries and products that leverage them.

Secondly, technologies to derive useful inferences from DNA sequences.

We know that the most common type of diabetes, i.e. Type 2 diabetes arises from the fact that human cells cannot respond properly to a pancreatic secretion called insulin. One of the genes that influences Type 2 diabetes is TCF7L2 in chromosome 10 which affects insulin secretion and glucose production. This means that just by looking at our DNA, we can tell if we have a susceptibility to diabetes and similar diseases in future. That exactly is the goal of DNA sequencing. The largest effort on DNA sequencing was the Human Genome Project which ended in 2003 at a cost of $2 billion dollars. Then three startups namely 23AndMe, Navigenics and deCODEme initiated the personal genomics revolution which allowed individuals to get their genome sequenced and helped cut down the cost of DNA sequencing. Besides companies, several individual innovators from legends like Craig Venter to the then 23 year-old student Eugene Chan contributed towards the algorithms and procedures to cut down the cost of DNA sequencing which has ultimately led us to where we are. Once we get our DNA sequenced by any personal genomics company there are services like interpretome.com, that can get those files as input and provide medical inferences which are extremely useful. Our genomes are all set to become yet another major component in our medical records, just like height, weight and blood pressure.

Back in 2008, one of the billionaire entrepreneurs named Sergey Brin (a cofounder of Google) got his DNA sequenced and realized that he had a good chance of being affected by Parkinson’s disease and since then he had started following suitable counter measures for avoiding the same. He had written about this in his blog here.

"This leaves me in a rather unique position. I know early in my life something I am substantially predisposed to. I now have the opportunity to adjust my life to reduce those odds (e.g. there is evidence that exercise may be protective against Parkinson's). I also have the opportunity to perform and support research into this disease long before it may affect me. And, regardless of my own health it can help my family members as well as others.

I feel fortunate to be in this position. Until the fountain of youth is discovered, all of us will have some conditions in our old age only we don't know what they will be. I have a better guess than almost anyone else for what ills may be mine -- and I have decades to prepare for it."

Trivia : One of the cofounders of the personal genomics startup 23AndMe, Anne Wojcicki, was Brin’s wife.

To understand more about the different forces that led to the genomics revolution, I would suggest you to read “The $1000 Genome” by Dr. Kevin Davies. This book beautifully sketches the various people and the companies that initiated this revolution and brought down the cost of sequencing by a huge margin. The cost to get an individual’s genome started from $999 dollars in 2007 to $399 in 2008 to $99 dollars right now (23AndMe). So, get your genome sequenced and know about yourself, literally. I have ordered a kit from 23AndMe and I am super excited about it. A revolution similar to the 1980’s PC revolution has happened silently (atleast to me!) and its high time we embrace this paradigm shift and appreciate its implications to take human civilization to the next level. Also, this is leading us to a whole new era of personalized medicine, where a drug is focused on per disease per person instead of just per disease.

Thanks to my friends at UCSD for inspiring me to read up on biology. Thanks to Hank Green for his wonderful biology lectures. And thanks to all the biologists for providing us better understanding about ourselves every passing day! Keep rocking, folks!

Advertisements

Let me answer the first question that pops up in your head.
Question   : Where the hell have you been the last one year?
Answer     :  I was lost rediscovering myself. Cryptic huh? I can assure you, once you reach the end of this blog post, you will find the meaning to that answer.

From my previous blog posts, you already know that I was an ordinary adolescent ceaselessly rambling about a zillion passions I wished to pursue. Trust me, the uncertainty continues even through my early 20’s. Despite the uncertainty, in due course of time, I have experienced the nature of work in two tech giants of varied origins and goals – Cognizant, a technology services company and eBay, a product company. This blog post summarizes what I have learnt in my brief stint in the corporate world.

Firstly, let me answer the question “Why did I choose eBay?”. To be honest, I did not choose eBay. I was not that laser-focused pro-active hyper-determined foresighted teenager you would find in college. When I sat for the eBay interview, I had absolutely no idea what I wanted to do in my life. My placement officer said its a dream offer. DREAM – that’s the word that pushed me. If getting into eBay is the dream of 500 odd students in my own campus, then its definitely worth a shot. So I attended the recruitment drive and I was in. And I must say that it was one of the best decisions I had taken then.

What followed after getting into the corporate life is what I would like to highlight in this blog post. Just bullet points (Though each point deserves a separate blog post on its own). Here we go.

Lesson 1 : “Its OK” to make mistakes

The initial tasks I was assigned as a fresher were dashboard/reporting tasks – to define in a nutshell, the kind of tasks that won’t bring ebay.com down if I mess up. I totally understood the rationale and I loved the work and learnt a hell lot about web technologies and project management in general. In a few days, I was fortunate enough to lay my hands on some core frameworks in eBay platform. One fine day, my very first change to eBay’s web service framework was about to go live and I made a tweeny blunder in the development to release process. Once I realized it, I was horrified. I thought there will be an outage. Consequently, eBay might lose a good number of customers and I am fired for sure. However, my manager comforted me with the words “Its OK to make mistakes in the initial stages”. That was an invaluable advice that came at the right time. I came back home thinking about it and eventually it seeped in deep into my character. In the days that followed, it helped me to learn things much faster and get myself up to speed with the other developers in my team. With a bit of self-retrospection, it occurred to me that I had feared to make mistakes my entire life. I did not cultivate that much-needed courage. Why? Interestingly, it has its roots in my primary education. I had been a bright student right from my primary school. Whenever I gave an exam, I made sure I don’t make a single mistake. Because, if I do, the chain of events would be like – make mistakes in exam – red ink marks on answer sheet – “You failed to score high marks” – teacher thrashes me – next exam – I don’t want to make mistakes because I don’t to “fail” and get beaten up. And sadly, I have been through this for over 15 years of my school life. So, my brain had taught itself to equate making mistakes to failure and punishment.

Now, I am better. I learnt that asking forgiveness for a mistake is easier and consumes lesser time than asking permission before doing anything new.

Lesson 2 : There is no box!

My team members love having healthy arguments and discussions. The topics ranged from machine learning to the pronunciation of the word “air”. During one of the technical discussions I had with my teammate, he mentioned that my thoughts were outside the box. That was the first time I heard someone use that phrase –  “outside the box”. It directly means ‘thinking from a new perspective’. But I was haunted with a different question – what the hell is this “box” anyway? Why do you visualize “perspectives” to a “box”. After running this question over and over again inside my head, I eventually realized that the box directly meant ossification that happens in the corporate world. You can easily tell engineers apart with reference to this simple criteria – if they are ready to challenge the status quo and innovate, or they just settle with what is just “there and working”.

What creates this difference? As time progresses, whenever we find that a problem is solved with a sub-optimal solution, say X, a few among us ask “why X?”, then, with a few email exchanges, they get the justification on why the solution is sub-optimal and live with it. They forget the next step – asking the question “why not Y?” where Y is the optimum solution. Keeping this mentality of “Why not?” alive will ensure we don’t confine ourselves in this virtual “box” of perspectives. This attitude alone can motivate us to get the big picture and innovate consistently. So we should remember – ask why, at the same time, think why not.

Lesson 3 : Scoping – Breaking a top level idea into achievable chunks, supported by a well-defined timeline

Scoping is one place where I have been failing miserably, but it went unnoticed since most of the tasks in school and college did not expect me to give a timeline for completion. In corporate life, since the projects in my team followed SCRUM model of development, I had numerous opportunities to test myself in scoping. Then, I realized that my timelines for a task X are generally based on two assumptions :

  1. I was the only person alive in office.
  2. X was going to be the only task I was going to work on. There would be no interruptions.

A 5-month experience in SCRUM model helped me to greatly improve upon my scoping skills which is a very important asset to any software engineer. Now, given a task X, I can comfortably break it down into a set of achievable chunks with a clearly defined timeline accommodating all kinds of possible interruptions. If not the best, I can definitely do it much better than what I would have done a year ago.

Lesson 4 : Importance of evaluating myself regularly

It is very important to evaluate ourselves against our end goals, regularly and religiously. In corporate life, in the constant stream of external noise that comes in the form of email, meetings and phone calls, we might end up in a vicious illusion of “important stuff”, clearly losing sight of our goals. We should keep asking ourselves the question “Am I inching towards my end goal with each passing day?” If the answer to this question is “No” for a considerable number of days, then its high time we take a drastic step to reset our priorities and get back on track. For this to happen, its very important that we set up some fixed chunk of time each week, where we go over our long term goals in corporate life and cross-check our current activities with the career trajectory we have projected for ourselves. In my case, I generally go missing from my desk from 3 pm to 4 pm every friday 😉 That is my self-evaluation time.  I stuck to the schedule religiously and it really helped me a lot.

I combine this weekly schedule with occasional micro-retirements of 2-3 days. During micro-retirements, I go home, lie on my bed and stare at the ceiling. Nothing else. It helps me to completely stay away from the external noise, allowing my inner voice to take control. Sounds strange and impossible to do. But once you do it, you will like it.

Lesson 5 : Importance and urgency are two different things

While at office, I used to compete with my team lead in literally everything work-related – requirements gathering, planning, scheduling, coding, usage of cutting-edge technologies, execution time, speed in which emails are replied.. well, you name it. Very soon, I realized that I was not as productive as he was. Apparently, I put in an equal effort (often much more) than he does, but still my productivity was no match to what he gets done in the same time. I initially doubted my execution skills, but later understood that the actual problem was in a different phase – Prioritization. It dawned upon me that I was mixing up urgency and importance. Most of the times, tasks come in the form of emails. In that context, when someone starts sending reminders on top of an actionable email, the corresponding task automagically climbs up my priority ladder. So, whenever I get a bunch of actionable emails, I prioritized them according to urgency ALONE, and that was a mistake. As usual, I was experimenting with different ways of prioritizing tasks. On a nice friday morning, I read about the famous Covey’s Time Management Grid. And (many would agree) fridays are the best days for experiments. So i tried it out. The beauty of Covey’s system is that its so simple that I started applying it to my experiments, and found visible results immediately. I am still evolving it to suit my needs. With this, I make sure that I am not just busy, but productive.

Additional point : I combine the time management grid with a rule called the 2-minute rule proposed by David Allen. It says “If you determine an action can be done in two minutes, you actually should do it right then because it’ll take longer to organize it and review it than it would be to actually finish it the first time you notice it.”. It helped me a lot. If you had not tried it earlier, I’d suggest that you give it a shot.

Lesson 6 : Time Management

Firstly, let me talk on buying time. The most lucrative source of time is meetings. Frankly 80% of the meetings can be eliminated by converting them to emails (Yes, I love Pareto’s 80-20 rule). Its true mainly because most of the meetings don’t have a strong discussion point. This leads to discussion on tangential topics without really coming to the problem under investigation.

I was able to convert a few meetings into emails which bought a good amount of time in office. There is a simple communication preference I follow – handle most of the queries through email, next step is phone call, finally resort to setting up meetings. Luckily, I did not have too many meetings. But, as anyone goes up the organizational hierarchy, there will be a need to present oneself and add value in multiple meetings. Having a clear communication preference will help then.

Secondly, its about saving time. I learnt that I work well when I set really hard deadlines to myself. If a task can be completed in 2 hours, I give it no more than 3 hours (including interruptions and coffee breaks). Because, I have a feeling that the task will swell in perceived importance and complexity in relation to the time allotted for its completion. As Parkinson famously stated in a 1955 edition of The Economist, “Work expands so as to fill the time available for its completion”. If we don’t limit it, it will limit our overall productivity and lay its hands on our peaceful work-life balance!

Thats all folks! Having spent an invaluable one year in the industry, I am taking these well learnt lessons to my next step in life – Masters in Computer Science at the University of California, San Diego.

Cheers!

I know that many people are like me – simple wandering about saying “yes” to whatever is asked. Spending most of the time dreaming what to do and suddenly a phone call reminds you that you need to go out to hangout with friends, submit your lab record or attend some meeting/function. In other words, not having a definite goal for yourselves and setting goals based on what you see around at that moment. What you are about to read is one such story – Ya, the story of myself. Read on and you might find a lot of similarities with your own life and that might bring up a smile on your face.

  • In my 10th standard, I wanted to become an archaeologist – I read about the various civilizations and even visited monuments and temples to read history. I talk with Sanskrit professors about the origins of India.
  • Then after seeing a big shot by the name Dr.Kathiravan in my hometown. He was a symbol of dedication, hardwork and passion. Then I wanted to become a doctor and serve the people.
  • I was naturally good at drawing (thanks to mom). I attended some painting classes during my 11th standard under Mr.Sylvester Peter. He used to say me that I have natural talent and could become a very good artist one day. Coincidentally I was already winning prizes at state level competitions. So, (you know a school boy’s mindset rite?)  I wanted to become a professional artist.
  • My father is a coach in my district cricket association. He taught me every nuance in fast bowling and made me a pretty good bowler. When I made it into the district team, I thought I should enter into the Indian cricket team one day.
  • When I reached the later part of 11th standard, I loved every concept in Physics and made a prototype of a Reverse Osmosis plant with my classmates. I was inspired by Albert Einstein, the man synonymous with the word “Genius”. I wanted to revolutionize the world by inventing the Time machine 😛
  • During my 12th standard, I wanted to be a polymath and started winning every extra-curricular activity I found in my way. My dream of getting state rank perished with that. But I was very, very happy travelling long distances and meeting new people.
  • The 12th annual holidays helped me get into better contact with my brother Vivek. My brother has been winning the best employee award every Q (Quarter of a financial year) ever since he entered into Robert Bosch. He is the youngest person to get an onsite job in the HQ of Bosch in Germany. Seeing him grow, I wanted to become a Mechanical Engineer.
  • Then since I was engrossed in Computer Games during the 12th holidays, my parents said that I might be naturally inclined to computers and enrolled me for BE Computer Science under Anna University, Chennai. And yeah, I did learn it with passion (like I did for every other activity :D)
  • I started learning Java in my first year under one of the Assistant Professors in my department. I made a calculator using Java Swing and said to myself that “Yeah! thats it man! I am the king of Java. I will learn all the packages within a month and create a really big project in it. Thus I can get into Sun Microsystems as a Java specialist”. (Naivety ruled me :D)
  • Then came the voices on Cloud Computing. I started working on Xen, read lots of Amazon white papers and made some *trivial* papers on Cloud Computing. I was working all alone then.
  • Then one celestial meeting occurred, I met my best friend Ahamed Nafeez in my own hostel. He too seemed to be in a similar wavelength as myself. When I talked with him, before I could realise we were best friends already. We decided to work in Networks. We did certifications togethers, won Network engineering competitions, paper presentations, and to cap it all, we did a workshop on Network security. During those days, my dream company was Cisco and Cisco only.
  • Then when I saw Android flourishing, I started hacking into android development. I was jaw-dropped on seeing the cool projects in the Android Developer Conference. I worked with my roommate Ganesh to create some cool projects involving a variety of Android technologies. We wanted to make a startup on Android Apps.
  • Then I got introduced to the Bhumi Social Foundation through Manoj. At this point, you should know that my entire family is known for social service. Even I got some accolades regarding that. So I was easily influenced and I got into that completely different world. Then I decided to  get into full time social service by becoming a member of Teach For India. I have already said about the phone interview I had. But with a second thought, full time social service did not look like a good idea. So I dropped it.
  • Then I got my first Wifi enabled phone Nokia E63. I used Internet in my mobile very often. When I found that browsing was too slow in wireless networks, I started working on a solution and found a problem with TCP performance.  I made a research paper on it and it will published as a proceeding in Springer LNCS in few days. I wanted to bring a change in the way Wireless Networks worked.
  • Then my interest in Python began to sprout out when GSoC 2011 approached. Though I couldn’t do GSoC this year due to my brother’s marriage, I got into another Summer of Code by Umit, which was also a part of GSoC. Then I started making a few hacks in Python and now am sitting at PyCon in Pune typing out this blog at an alarming speed 😛 Now I dream of becoming an expert python hacker. 😀

To finish it off, I realize that what I am now is just the remnant of all the previous Narendrans I had been throughout my life. Sorta jack of all trades. Seeing the specialist Python Hackers around me makes me feel guilty of not having done anything significant. I have tried atleast a 100 different things in the past six years that went undocumented and unnoticed :P. Saying this, even my future is uncertain. Few years down the lane, I have no idea what I would be doing. I don’t even know if this is strange or this is a “Typical Adolescent Thinking”. I need to specialize in one field through which I can effectively serve the community. DOT.

When I was hopelessly lamenting this to my mom, she replied, “What is the highest position in your field? Something named Google rite? I don’t want you to get in there and break your head. You got placed already. Be happy for that. Oor suthify with your friends, get married in a couple of years, settle happily and speak Tamil at home. Thats enuf. And dont ever take this topic again when on phone or when at home!!”

In a nutshell : I say “Enna valka da idhu”, Mom says “Keep it simple silly!” 😀

Though I have loads of things to blog about, am settling down with the life lessons I have learnt through my varied experiences as a son, brother, friend, student, painter, gamer, social servant, hacker, team leader and an insane thinker. The final result I got after brainstorming myself is something that is better felt than being listened to. Here is the depiction of what I figured out from my little 20-year experience.

Lesson 1 :
You can become whatever you wish to become with sheer dedication and hardwork. Be it a doctor, computer engineer, scientist, painter, musician, Anna Hazare, or Osama Bin Laden, you name it! But what matters is what you love to do.. What you are made for.. What every cell of yours is inclined to do.. What is it that you can do 24x7x365 tirelessly with complete passion. That is your destiny. Don’t waste your life trying to become someone else. Life is counted on how much you have enjoyed by being yourself.  Don’t hide your true potential just because you feel that its not upto the mark. You are already awesome 🙂

The obvious question is “How do we find what we are made for?”. Answer – No one else other than you could find it. Ask yourself and get confused a million times, you will find the right answer one day.

Lesson 2 :
My life in Chennai taught me a hell lot about relationships. Ofcourse, am learning some hard lessons even now. But one fundamental concept I noticed is that – Many people in Chennai are NOT what they seem to be. They pretend to be that “someone else” for the sake of getting accepted by the society. And thats hilarious. When you are true to yourself and to the community around you, whatever you get would be a genuine fit for you. Even if you have very few friends, you could be 100% sure that they are true to you.

In short – Don’t waste your life trying to become something. Do what you love to do, and automagically you will become the one you are destined to be. A fantastic life is guaranteed if you start living YOUR life right now and enjoy every moment.

You might think that these are the words which you find on some lame books like “You can Win” or some Share-Auto’s cover. But trust me.. This is the Ultimate Truth.

Still I have lot more to say, but for now its better if I halt with this 😛

Courtesy – The innumerable times I’ve spent time thinking about human life and to my role model who has been my inspiration since birth, my lovely lovely brother Vivek Thangarajan.

Cheers! 🙂

I’ve been wanting to share this for quite long. Am extremely happy to say that I got placed (along with @madhuvishy @TheAkj and Divya) in the reputed eBay-PayPal for a pretty decent compensation package. 🙂 So here is the story how I made it.

eBay - Paypal

eBay-PayPal is the first company that came for recruitment in my college. So almost everyone of us was really excited about how the interview process is gonna be. We discussed a lot among ourselves about how the questions might be and had a good laugh over some really funny arguments. Pure #Naivety 😛

Initially the eligibility criteria for attending the recruitment process was 90% in 10th, 12th and in college without standing arrears!! Manasatchilessly daunting, isn’t it? I see that you couldn’t help yourself from avoiding that jaw-dropping expression adorning your visage. That’s how we stared at our Placement Officer when he announced it. When he found that only one person was eligible from the whole college, he relaxed one of the constraints. From 90%, the cutoff dropped to 75% till 6th semester in college. Yet the 90% in 10th and 12th remained. I WAS IN!

The recruitment process started on August 1st (My  Birthday 🙂 ) The first round was a written test. The “legen-dary” Multiple Choice Questions. We had 30 questions out of which (to our surprise) about 60% was based on Java and C++, while the rest of the questions spanned around verbal and quantitative abilities. To be more specific, here are a few niches you could focus on..

  • OOPS concepts – Data abstraction, Excapsulation, Virtual Destructors etc.
  • Database – SQL Queries and the basics
  • Networks – Subnet addressing
  • Probability – coupled with Permutation/Combinations
  • Analogies

We were given the question paper, an OMR sheet and 45 minutes to crack the questions. To be frank, the questions were easy and I was wondering how the eBay recruitment team is gonna choose from the competitive scores. But after half an hour, a set of 22 students were shortlisted from the talented lot. And I was one among them 🙂 That marked the end of the day.

The next day we had a series of Technical Interviews. The interviewers tested our knowledge on pattern matching, logical thinking, problem solving skills, Java, DBMS and Data Structures. And regarding Java, most of the questions were from java.util.Collections Framework. Poor me! Having no idea about this one topic, I was struggling with the Java questions. I m pretty good with the DBMS concepts, so that overshadowed my “Java Deficiency Syndrome”. And all thanks to my considerably strong resume. And I hold an 8.6 CGPA – neither too good nor too bad. So I had my resume as the trumpcard. Since I had two really good projects on DBMS and Java, one submitted to IBM and the other which fetched me a 30k bounty at the National Level Database Design Competition at IIT-K, I was confident. Another challenge I faced there during the interview was that I was more of a computer networks guy than a hardcore programmer, yet I had to project myself as a software developer there.

In my case, the third round of Technical Interview was skipped. And finally, by the end of the day, they read out five names including mine. I thought that it was done and I was in! But then dawned the ultimate twist. The HR interviewer Ms.Kalaivani said, “You guys are shortlisted for the final round, which will be held at eBay office tomorrow”. On hearing that the inner voices of all five of us resonated “OMG! Not AGAIN!!”. Of course, everything is for getting into a good company.

The next day, a gorgeous Innova drew up near my hostel gate at around 1 pm. I was comfortably escorted to eBay office where I met my four colleagues. The workplace was cool (pun -the A/C :P). The employees there dint seem tensed at all. So I was really motivated to get such a tension-free yet high-paying job offer.

There we went through two more rounds of technical interview. This time it was us who did the talking. In my case, the interviewers were keenly interested in knowing about every line in my resume. Thus it was almost a cake walk for me then.  The final round was a HR interview with the mundane “Tell about yourself” and “What your strengths and weaknesses”. After everything was done, the same Innova car ensconced me back to my hostel. Thus ended the awesome experience!! And the very same night, we got the results from the eBay office. Thus after a written aptitude test, four rounds of Technical Interview and an HR Interview, I WAS SELECTED!!  So this is where I would find myself in a few months..

eBay-PayPal Office in Chennai

Thus happily everafter 🙂 Cheers!

<Note> Absolutely No Statistics. Purely Experience </Note>

Well, its counseling time in Tamil Nadu and the students are already super perplexed on which college to choose. There are generally two ways students choose their college.

1. Best College — Whatever Department is available

2. Favourite Department — Whatever College is available.

I would flatly say them to choose their favourite department in any college in a CITY for various reasons. Though the word CITY seems general, I infer the following from my migration from Sivakasi to Chennai. To list a few of the merits..

Being in the city, you could get along with a good mixture of people from all corners of India. Mingling with them will often mandate the use of English. Thus you need not attend any spoken English classes for bettering your communication skills. Getting embarrassed a couple of times is the fastest way to develop your English knowledge. 😉 By the time placements are on, you are already an eloquent and attractive speaker.

In terms of technology, cities are (on an average) two years faster than other towns and villages in India. Well, its obvious. Since the city side students are exposed to such knowledge right from their birth, they are undeniably a step ahead of other students from villages. Thus getting in touch with them would help you learn and grow faster. And within a year you could find yourselves standing on par with them in every aspect of life. And remember, its not about competing with them, its about growing together. Many don’t understand this and fall into a conundrum.

City is the place where the things are happening for real. Like there is difference between reading about a Grand Startup Fest in a newspaper and being a part of that Grand Startup Fest itself. So being in the city offers you the chance to participate in many organisations which hitherto had been only in your monthly digests/newspapers.

The best coaching centres for GRE/CAT/GATE/You-name-it is present in the City. In Chennai, there are Time, Kaplan, Career Launcher, IMS etc. Numerous students get into top-notch universities through such coaching. And this is a major advantage.

About the culture. As with the variety in languages, you could enjoy a variety of cultures and mannerisms. It is a little hard to be yourselves when people around you sport enticing gears and cinematic lifestyles. But that is left to you.

Now getting down to the Computer Science stream, I would easily say that am enjoying a lot more features than any student in any other part of TamilNadu, just because I am in Chennai. The number of technology communities in Chennai is remarkably high that its tough to choose where you want to be. And each community is flourishing at a blistering pace. For the list of groups in Chennai you can refer to the list made by Kevin William David – http://blog.kevinwilliamdavid.me/2011/06/05/list-of-startup-tech-groups-in-chennai/

There are meetings from the Chennai’s Linux User Group where open source enthusiasts share knowledge by taking seminars on various topics. Then there is this Nerd Dinner wherein you could meet the nerds from all over Chennai and have dinner with them. Then there is the Python Group, Android Group, and loads of startup groups which guide you with your entrepreneurial skills. Thus you are never alone. You always have an excellent team working with you.

Though there are a few negative points, like the other side of the coin, I don’t think it would overshadow the merits of being in a college in city.

So thats it.. Just wanted to share this opinion.

Cheers 🙂

Its been almost a couple of weeks since I bought my Samsung Galaxy S2 and am completely in love with it. I believe that the current trend among the youngsters is like – Gadget companies are like religions. You follow one and keep your mouth shut about other companies. In that sense, I worship the Android OS ( with a true spirit of an open-source enthusiast ) Its been just a few days since I started using it and now my routine work has become much comfortable.

As they say “Character maketh a man”, I would say “Apps maketh a platform”. Even the phenomenal growth of Facebook could be attributed to the bountiful of apps that came flooding in every day. Now talking about apps, I started downloading numerous apps through Android market and it was during this time that I downloaded these two apps which have changed the way I use mobile phones.

<JustSaying> I know am late in this review. These two apps are already topping the charts in the market. But still I thought I could share my viewpoint on them  🙂  </JustSaying>

1. DropBox : Dropbox is a free service that allows you to have all your photos, music, docs, and apparently every thing on your PC or mobile on to the cloud and make it accessible to all your devices wherever you are. Once you download (http://www.dropbox.com/) and install this app on to your phone and PC, you are not going to search for your pen drives anymore. After the installation, a folder named “Dropbox” is created on your system. In my system, the folder looks like this :

The Dropbox folder

The Photos folder in my Dropbox

Note : The tick mark indicates that the folder is completely synced with your Dropbox cloud storage.

And  this is the Dropbox folder on any Android phone :

Dropbox on Android

2. Evernote : If you are one of those persons who finds it insanely laborious to keep your notes synchronized among your phone, Windows and Linux desktops, you are not alone. Maybe you “were” not alone. Because I found this solution to be really good. This app named Evernote, is once again, like storing your notes in the cloud and accessing it from anywhere. Be it on your Windows desktop, Ubuntu Workspace or Android phone. You can make clippings of your webpage or even store a snapshot/pic as a note and sync it with your evernote account. Moreover, editing and syncing text is done so quickly that you don’t even realize that its connected to the web.

This is how Evernote looks on Android phone :

Evernote Screenshots - courtesy : TechCrunch

Evernote is not available for Ubuntu currently. So I use an open-source alternative called “NeverNote” (hilariously named) which could be downloaded at http://nevernote.sourceforge.net/. It offers almost the same functionalities as the original Evernote app.

Of course there are a lot of alternatives available to these two apps. But, according to me, these two are the best among them.

Good use of technology can save a lot of time, in terms of hours or even days. Lets celebrate technology!! Cheers 🙂

Today I had my first experience of a phone interview, and it was from the NGO named Teach For India (TFI) . To describe TFI in a few words,

Teach For India is a nationwide movement that aims to bridge the educational gap in India by placing outstanding college graduates and young professionals in low-income schools to teach full-time for 2 years. - TFI

Inclined to social service and already being a part of Bhumi Foundation, I wanted to see how TFI, one of the biggest social service foundations, work to enhance education in India. So I applied for the Campus Ambassador post for the year 2011-12 less than a week back and today they called me at 12.30 noon for the interview. The lady with the sweet voice introduced herself and asked if I was ready for the interview. This happened when I was waiting for food in a hotel wearing a hunger-stricken face. But I was OK with it and the interview began. Though I was overwhelmingly excited on my first phone interview, I tried to maintain a grim and complacent voice replying her every statement with a perfectly professional toned “Mm hmm” “Ya, of course” “That’s awesome” almost like an adjectived and adverbed version of Dhanush’s GD in Yaaradi Nee Mohini. Then she asked a few of the cliched questions in the history of interviews like “Say about yourself”. I managed to answer that as short as possible. Unfortunately, she was expecting a more verbose edition of the same reply and waited for me to continue #awkwardsituation. Being an Engineering student, it was easy for me to bloat the answer with some cleverly articulated anectodes (from my own life, honestly) and went on for an alarming 15 minute reply for the same question. She was like “Wow!!”. And I was like “Nalla vela”.

Then came the tricky part – Role playing. I have to don the role of a Campus Ambassador and she is a fourth year college student. I have to persuade her to join TFI. Pretty interesting stuff.. I started with “Hey wassup?” and she replied with a tedious answer bringing the words “GRE” (to which am pointlessly allergic), “Placements”, “Exams every week” and she characterized herself as a typucal busy, geeky girl in final year. Without an explicit hint, she made the point clear that she is a stubborn, studious girl who is more focussed on her own life than on others’. That was pure talent. Maybe her 2 years experience in recruitment helped her with that. Btw I somehow managed to persuade her into TFI. Next, was another Role Playing wherein am the Campus Ambassador and she is the Placement Officer. This was tougher than the previous since she spoke flawlessly on the difficulties in becoming a fellow of TFI. I was left completely breathless. After a 10 second break, I started a counter reply, where I enlisted the advantages of becoming a TFI fellow after college and how companies respect the position of “Fellowship in TFI”.  Once again I succeeded in persuading her. And she remarked that the interview was “very well done”. But I am quite dubious about the result.

Moreover I myself am in a dilemma whether to pursue it or not. I do want to help the society. But is it the right time to dive headlong into it, is the question. Because we know “With great power, comes great responsibility”. In case, if I get to become the campus ambassador, I must dedicate the time the post of ‘Campus Ambassador of TFI’ deserves. Will I be able to do that? With this question haunting my mind, and letting Time to decide the solution, I end this post.

🙂

You know which organisation makes the most sightly products in the world? I hear “Apple”. Well I don’t regret it. But for me, it is the nature. Sometimes we keep searching tirelessly for the best of things, and finally come to know that it has always been there with us for long. One such phenomenon is nature. Since my childhood, the stunning beauty of the various weather phenomena has never ceased to amuse me. Its just fabulous. I used to read a lot about the science behind natural wonders. Be it the lightning, the rainbow or whatever. And among them, lightning, by far, is the most spectacular phenomenon I have ever seen. And the science behind it is much more amazing.

In this post, I have chosen a specific question “What causes the thunder? Is it the clouds or the lightning itself?”. The question hit my head so hard, that I sprang out of bed and started reading about it. The source of thunder has been a subject of speculation and scientific enquiry for centuries. Briefly, my answer would be – The source of thunder is clouds if you are a 6th grade and lightning if you are a 12th grade. Baffled? But, this is how I was taught in my school.  My primary school teacher said thunder is heard because the clouds “dash” against each other. How on hell could accumulated forms of water vapour literally DASH. But, with a bit of retrospection, it was the first ever speculation made on this subject by Aristotle in the third century BC. So here goes the real scientific reason of 21st century.

Lightning - An incredible concept

Lightning, one of the celestial forms of electric discharge, has a diameter of one to two inches. 90% of this electric discharge is released in the form of heat, which immediately dissipates into the atmosphere (Out of the remaining, 1% is dissipated in the form of sound, and the rest in the form of light). This heats the air surrounding it to about 70,000°C which is about three times the temperature of sun’s core. Now, we all know that “Air expands on heating”.  This violent increase in the pressure and the temperature causes the surrounding air to expand in a blistering pace. And now on to the next fact “Hot air rises up” – This superheated air causes a shock wave that extends radially outward for a diameter of almost 30 feet and it spontaneously races upward at a rate faster than the speed of sound (A sonic boom – we could call it). While this is in progress, as and when the lightning from the clouds connects to the ground, a second stroke of lightning will be shot back from the ground to the clouds tracing the very same channel as the first strike. This is why we could see the lightning “withdrawing” from the ground. When lightning vanishes into the clouds, the superheated air, is rapidly cooled due to the surrounding air, thus rocketing the pressure to 100 times the atmospheric pressure. This haphazard expansion and contraction causes the column to vibrate like a tubular drum head and produces a tremendous crack. As the vibrations get dampened out, it generates a low rumbling which we call thunder.

Now about the propagation of thunder, most of the lightning streaks are close to vertical since electricity follows the shortest route. Thus the shockwaves from the ground reach our ear first, followed by the shockwaves from higher altitudes (simple high school trigonometry). But when the lighting bolt forks out into innumerable branches, the intensity of the electric discharge is reduced considerably when it reaches the ground and thus the thunder’s sound pattern changes.

Finally, let me wrap things up with awe-inspiring pictures of certain special forms of  lightning. Like the stargazers, I would call myself a lightning-gazer. Talking about lightning, I thought the post would be complete, if I had discussed the science behind the creation of lightning too. To have the post brief, am saving it for the next post on “Fascination Physics”. Now its time for some eye-candy..

The Return stroke of a Cloud-to-Ground Lightning

 

Cloud-to-Cloud Lightning - reminds me of Vampire movies

 

Thunderstorm accompanied by Cyclone

 

The Ball Formation of Lightning

 

And finally…

The Diwali Special

This post is about reality. The reality that you can’t become whatever you dream to become. I know it makes a negative impact, but I guarantee to have a happy ending.

This thought was inspired by the quote “The whole word is a drama stage, men and women merely actors” by Shakespeare. This has been intriguing me for long.

Where it all started? I would cite two very different instances.

1.  My grandpa wanted to study abroad. But it just stayed as his dream due to his family’s economic status. And after two generations, am gonna make his dream come true through my Masters Degree in US. Similarly, I wanted to become a doctor. Ironically, I can’t even stand someone bleeding for more than 2 seconds!! So I would entrust that dream to my son or daughter. And I have to find what my account holds for me..

2. The second is the character “Lady Gaga”. Seeing her perform on stage, I find that she is perfectly made for entertainment and absolutely nothing else. She can never become an academician even if she holds a hunger strike till death.. She has found what she is meant for, which according to me, is her greatest achievement. She is doing the best in her field.

So you just get what is written in your account, nothing more, nothing less. That’s what life is all about. Its useless to keep dreaming about becoming a celebrity or a superstar. First thing to do is to identify the role assigned to you by God. Is it a musician, dancer, architect, dramatist, singer, academician or one of million others? Until you find that role, don’t settle.. Keep hunting for that one thing you are made for. That is the reason for your existence. That is your reality. Until you find that role, you are just living someone else’s life, wearing a mask of satisfaction. Once you find it, start chasing. Don’t ever look back. Trust your intuition, karma, insight orwhatever you call that instinct. Don’t let other people’s voices drown your own precious inner voice. Just stay calm and listen to what it says and pursue the goal it renders in your mind. The more you know abt it, the more you’ll want to get it. Like any relationship, it grows better and better with time. Then one day the whole world would seem to work for you and by then you are already on top of the world. You have proved yourself to God that you did your role well. You are now called a celebrity.

Thats what happened to those two people, whom I mentioned above. My grandpa became one of the pioneers of bringing in industries to my native Sivakasi in Tamil Nadu. And on a global perspective, Lady Gaga rose from ignorance to elegance.

An aimless life is like riding a car without destination. Thus to become a successful person, we need to know our role (ie. our reason for existence) and perform it to the fullest. Once we start enjoying every moment playing that role, we slowly become dearer to God and success will follow. The ultimate secret is to “Identify what we are made for” and pursue that cause. Everything else is trivial.