Recently, I have been reading up on biology and I am fascinated by some of the recent developments and realizations in this field. So, I decided to write about it and here we are. Disclaimer : I am going to be deliberately handwaving in a few explanations so that most of the us can understand and appreciate the concepts. For those interested in the exact details, I have linked related references.

Have you ever asked the following questions to yourself?

  • Why do I have a distinct head, neck and a body? And why not wings so that I can fly?
  • Why do I have two legs, two hands, two eyes, two ears but only one nose?
  • Assuming the above two happen magically, still, why is it that each of my hands has exactly 5 fingers in the exact same order as others?
  • What influences the color of my hair, skin, eyes etc.?
  • How can I see, smell, hear and speak like every other person? Why not have a couple of antennas and smell through them?

After all, all of us humans come from a single unique cell created in our mom’s womb and so there should be no reason for us to look similar. When questions like those mentioned above come up during conversations or during solitary contemplations during my bus travels, I usually justify them with universal answers like “God” or “nature” or “hey, its simple evolution! Nothing fancy there!”. Then the following fundamental questions ensue,

  • What is evolution?
  • If evolution occurs somewhere between parents and offsprings, how does it happen exactly, when does it happen and where exactly in the human body? (Well, it has to be somewhere in the human body, right?)

Now that I have a little bit of understanding on the underlying biology, I am starting to appreciate these seemingly subtle things which constantly evaded my attention because I was, you know, busy. The answer to all the above questions is not centralized to a metaphorical “heart” or any other single location in the human body. The answer lies in every cell in our body. Its the deoxyribonucleic acid aka DNA. Lets dive in!

Human Cell –> Nucleus –> Chromosomes –> DNA –> Genes

A recent study from University of Bologna tells us that the total number of cells in the human body is around 3.7 x 10^13. Each of these cells looks like the one shown below (top left part). There are exceptions like red blood cells, which don’t need/have a nucleus since their main role is just transportation of oxygen.

Where exactly is our DNA?

Where exactly is the DNA in human cell?

Each of the trillions of human cells in your body has a central nucleus, which in turn has a ridiculously convoluted chromatin sphagetti, which contains 23 pairs of chromosomes. Why is it a pair? In each pair, one is from your dad and the other one is from your mom! I see that you want to call your parents already.

Now, each of the 46 chromosomes is made up of tightly wound double helical strands of nucleotides called DNA. The two strands are connected by a series of “base pairs” which are composed of A, G, C or T. If we unwind all the DNA strands from all the 46 chromosomes from a single cell in your body, it will come up to 3 kms (reference). If we stretch out such a strand, we will have 6.4 billion base pairs (AT, GC). And a gene is nothing but a logical grouping of these base pairs.

Genes - logical segments in DNA

Genes – logical segments in DNA (Image Courtesy : Plant and Soil Sciences eLibrary)

Gene sequence –> Human Traits

What is so special about a gene is that each gene corresponds to one or more of our traits (like height, obesity, hair color, ear wax etc.). Sometimes a group of genes can affect a trait. Based on the number of genes that affect a trait, each of our human traits is categorized as polygenic, pleiotropic or mendelian. Next, to better understand this concept, lets take up an ordinary human trait which we all hold. For instance, I am less sensitive to smell as compared to my peers. This is a mendelian trait i.e. It is influenced by a single gene called OR11H7P which is present in chromosome 14. Zooming in further, the sequence of bases in OR11H7P in chromosome 14 (reference) is supposed to look like the following :

ATGAATAACTCACAGATATCTACTGTGACGCAGTTTGTGTTGTTGGGGTTTCCTGGTCCC
TGGAAAATTCAGATCATCTTTTTCTCAATGATTTTGTTGGTCTACATCTTCACTCTGACT
GGGAATATGGCCATCATCTGTGCAGTGAGGTGGGACCATCGACTCCATACCCCTATGTAC
GTGCTCCTAGCCAACTTCTCCTTCCTAGAGATCTGGTATGTGACCTGCACAGTCCCCAAC
ATGCTGGTAAATTTTTTCTCCAAAACTAAGACCATATCATTCTCTGGATGTTTCACTCAG
TTCCACTTCTTCTTTTCCCTGGGCACAACTGAATGCTTCTTCCTCTGTGTCATGGCTTAT
GATCGGTACCTGGCCATCTGCCACCCACTGCACTATCCCTCCATTATGACTGGCCAGCTC
TGTGGCATCTTGGTGTCTCTTTGTTGGCTCATTGGTTTCCTTGGACATTCAATTTCCATT
TTCTTCATTTTTCAACTACCTTTCTGTGGTCCCAACATCATTGATCATTTTCTGTGTGAT
GTAGACCCACTGATGGCATTGTCCTCTGCCCCTACTCACATCATAGGGCATGTGTTCCAT
TCTGTGAGCTCTCTTTTCATCAACCTCACCATGGTGTACATCCTTGGGTCCTATACCTTG
GTGCTCAGAACTGTGCTTTAGGTTCCTTCTTCAGCTGGATGGCAAAAGGCCATCTCTACC
TGTGGGTCACACTTGGTTGTTGTGTCTCTGTTCTATGGAGCCATAATGCTGATGTATGTG
AGTCCCACACCTGGCAACTCAGTTGCTATGCATAAGCTCATCACACTGATATATTCTGTG
GTAACACCTGTCTTAAACCCCCTCATCTACAGCCTACGCAACAAGGACATGAAATATGCC
CTCCATCATGTCTTCTGTGGAATGAGAATTATCCAGAGATCA

The above sequence is perfect and would have made me super sensitive to smell. However, thanks to gene variations (or more specifically SNPs or CNVs) that came through my mom or dad, my ability to sense smell has gone down. But how?

Diving deeper : From gene sequence to sense of smell 

The next obvious question is “how do you say that the above gene sequence of OR11H7P affects the way we smell”?

As far as any protein/hormone secretion is concerned, it happens in two steps within a human cell. Firstly, transcription causes the gene from inside the nucleus to be encoded on a messenger RNA (mRNA), which is shipped to organelles inside the same cell called ribosomes (which are generally sticking on to another organelle called rough endoplasmic reticulum). The ribosomes are like the binding spots for mRNAs and things called transfer RNAs (tRNAs). tRNAs provide the building blocks for all proteins. As a result of this binding called translation, the gene sequence encoded in mRNA is translated to long polypeptide chains which are in turn sent to another organelle called the Golgi Apparatus which ultimately produces the hormone/protein required for that corresponding part of the body to perform its task. E.g. In case of the sense of smell, the cells are the olfactory cells in our nose and the proteins are called olfactory receptors which do the actual sensing of smell.

Now that we have understood the impact of one gene named OR11H7P on our body, we should also know that the Human Genome Project put the total number of genes to somewhere around 20,000 to 25,000. So imagine how every gene could affect each part of your body. Then, think of the complex machinery and the billions of incredibly coherent and consistent operations happening right now in your body. Isn’t that amazing! Thus the DNA is like the governing body for the human cell. It instructs every cell what to produce, how to produce, when to produce, what to grow, how to grow etc.

For the complete set of human genes to human traits mapping, remember that there are 23 pairs or chromosomes in the human cell and read the compilation at Eupedia. For a more thorough understanding on this subject, read up on Single Nucleotide Polymorphisms (SNP), Copy Number Variations (CNVs) and the Genome Wide Association Studies (GWAS). That should answer the first set of questions we had.

Now that we have a better sense of how exactly we are what we are in terms of size, shape, color, behavior etc. it should be obvious that the evolution is merely selection of better (or more suitable genes) when the offspring is created. One of the major factors that helps evolution lies in a process called meiosis which is responsible for generation of sex cells from oocytes and spermatocytes. There is a particular step called “homologous recombination” after the “crossing-over” step where the parental genes unlink and recombine in various combinations. This means that each sex cell would have a different blueprint of a human being. So we look like what we are right now because of the male sex cell and the female sex cell that combined to create the original zygote. A different combination would have led to a different human being with different selection of traits. As simple as that. Besides this, there is also the effect of human migration across countries and continents on the mix of genetic composition of people in different places. And this answers the second set of questions we had.

Future directions :

Firstly, research. More research.

Interestingly, we might tend to think that all the biological processes could be studied easily by observing every biological process under a super-powerful microscope. But for some reason, it is not that simple. For example, the effect of a protein called dynein on the most fundamental cell division process called mitosis was discovered as recently as February 2012 by Tomomi Kiyomitsu from MIT (reference).  This is 134 years after Walther Fleming originally observed mitosis. Given the nascency of the field of genetics research and the enabling technologies around it, there is no doubt that we have a long way to go in terms of discoveries and products that leverage them.

Secondly, technologies to derive useful inferences from DNA sequences.

We know that the most common type of diabetes, i.e. Type 2 diabetes arises from the fact that human cells cannot respond properly to a pancreatic secretion called insulin. One of the genes that influences Type 2 diabetes is TCF7L2 in chromosome 10 which affects insulin secretion and glucose production. This means that just by looking at our DNA, we can tell if we have a susceptibility to diabetes and similar diseases in future. That exactly is the goal of DNA sequencing. The largest effort on DNA sequencing was the Human Genome Project which ended in 2003 at a cost of $2 billion dollars. Then three startups namely 23AndMe, Navigenics and deCODEme initiated the personal genomics revolution which allowed individuals to get their genome sequenced and helped cut down the cost of DNA sequencing. Besides companies, several individual innovators from legends like Craig Venter to the then 23 year-old student Eugene Chan contributed towards the algorithms and procedures to cut down the cost of DNA sequencing which has ultimately led us to where we are. Once we get our DNA sequenced by any personal genomics company there are services like interpretome.com, that can get those files as input and provide medical inferences which are extremely useful. Our genomes are all set to become yet another major component in our medical records, just like height, weight and blood pressure.

Back in 2008, one of the billionaire entrepreneurs named Sergey Brin (a cofounder of Google) got his DNA sequenced and realized that he had a good chance of being affected by Parkinson’s disease and since then he had started following suitable counter measures for avoiding the same. He had written about this in his blog here.

"This leaves me in a rather unique position. I know early in my life something I am substantially predisposed to. I now have the opportunity to adjust my life to reduce those odds (e.g. there is evidence that exercise may be protective against Parkinson's). I also have the opportunity to perform and support research into this disease long before it may affect me. And, regardless of my own health it can help my family members as well as others.

I feel fortunate to be in this position. Until the fountain of youth is discovered, all of us will have some conditions in our old age only we don't know what they will be. I have a better guess than almost anyone else for what ills may be mine -- and I have decades to prepare for it."

Trivia : One of the cofounders of the personal genomics startup 23AndMe, Anne Wojcicki, was Brin’s wife.

To understand more about the different forces that led to the genomics revolution, I would suggest you to read “The $1000 Genome” by Dr. Kevin Davies. This book beautifully sketches the various people and the companies that initiated this revolution and brought down the cost of sequencing by a huge margin. The cost to get an individual’s genome started from $999 dollars in 2007 to $399 in 2008 to $99 dollars right now (23AndMe). So, get your genome sequenced and know about yourself, literally. I have ordered a kit from 23AndMe and I am super excited about it. A revolution similar to the 1980’s PC revolution has happened silently (atleast to me!) and its high time we embrace this paradigm shift and appreciate its implications to take human civilization to the next level. Also, this is leading us to a whole new era of personalized medicine, where a drug is focused on per disease per person instead of just per disease.

Thanks to my friends at UCSD for inspiring me to read up on biology. Thanks to Hank Green for his wonderful biology lectures. And thanks to all the biologists for providing us better understanding about ourselves every passing day! Keep rocking, folks!

Advertisements