Latest Entries »

Recently, I have been reading up on biology and I am fascinated by some of the recent developments and realizations in this field. So, I decided to write about it and here we are. Disclaimer : I am going to be deliberately handwaving in a few explanations so that most of the us can understand and appreciate the concepts. For those interested in the exact details, I have linked related references.

Have you ever asked the following questions to yourself?

  • Why do I have a distinct head, neck and a body? And why not wings so that I can fly?
  • Why do I have two legs, two hands, two eyes, two ears but only one nose?
  • Assuming the above two happen magically, still, why is it that each of my hands has exactly 5 fingers in the exact same order as others?
  • What influences the color of my hair, skin, eyes etc.?
  • How can I see, smell, hear and speak like every other person? Why not have a couple of antennas and smell through them?

After all, all of us humans come from a single unique cell created in our mom’s womb and so there should be no reason for us to look similar. When questions like those mentioned above come up during conversations or during solitary contemplations during my bus travels, I usually justify them with universal answers like “God” or “nature” or “hey, its simple evolution! Nothing fancy there!”. Then the following fundamental questions ensue,

  • What is evolution?
  • If evolution occurs somewhere between parents and offsprings, how does it happen exactly, when does it happen and where exactly in the human body? (Well, it has to be somewhere in the human body, right?)

Now that I have a little bit of understanding on the underlying biology, I am starting to appreciate these seemingly subtle things which constantly evaded my attention because I was, you know, busy. The answer to all the above questions is not centralized to a metaphorical “heart” or any other single location in the human body. The answer lies in every cell in our body. Its the deoxyribonucleic acid aka DNA. Lets dive in!

Human Cell –> Nucleus –> Chromosomes –> DNA –> Genes

A recent study from University of Bologna tells us that the total number of cells in the human body is around 3.7 x 10^13. Each of these cells looks like the one shown below (top left part). There are exceptions like red blood cells, which don’t need/have a nucleus since their main role is just transportation of oxygen.

Where exactly is our DNA?

Where exactly is the DNA in human cell?

Each of the trillions of human cells in your body has a central nucleus, which in turn has a ridiculously convoluted chromatin sphagetti, which contains 23 pairs of chromosomes. Why is it a pair? In each pair, one is from your dad and the other one is from your mom! I see that you want to call your parents already.

Now, each of the 46 chromosomes is made up of tightly wound double helical strands of nucleotides called DNA. The two strands are connected by a series of “base pairs” which are composed of A, G, C or T. If we unwind all the DNA strands from all the 46 chromosomes from a single cell in your body, it will come up to 3 kms (reference). If we stretch out such a strand, we will have 6.4 billion base pairs (AT, GC). And a gene is nothing but a logical grouping of these base pairs.

Genes - logical segments in DNA

Genes – logical segments in DNA (Image Courtesy : Plant and Soil Sciences eLibrary)

Gene sequence –> Human Traits

What is so special about a gene is that each gene corresponds to one or more of our traits (like height, obesity, hair color, ear wax etc.). Sometimes a group of genes can affect a trait. Based on the number of genes that affect a trait, each of our human traits is categorized as polygenic, pleiotropic or mendelian. Next, to better understand this concept, lets take up an ordinary human trait which we all hold. For instance, I am less sensitive to smell as compared to my peers. This is a mendelian trait i.e. It is influenced by a single gene called OR11H7P which is present in chromosome 14. Zooming in further, the sequence of bases in OR11H7P in chromosome 14 (reference) is supposed to look like the following :

ATGAATAACTCACAGATATCTACTGTGACGCAGTTTGTGTTGTTGGGGTTTCCTGGTCCC
TGGAAAATTCAGATCATCTTTTTCTCAATGATTTTGTTGGTCTACATCTTCACTCTGACT
GGGAATATGGCCATCATCTGTGCAGTGAGGTGGGACCATCGACTCCATACCCCTATGTAC
GTGCTCCTAGCCAACTTCTCCTTCCTAGAGATCTGGTATGTGACCTGCACAGTCCCCAAC
ATGCTGGTAAATTTTTTCTCCAAAACTAAGACCATATCATTCTCTGGATGTTTCACTCAG
TTCCACTTCTTCTTTTCCCTGGGCACAACTGAATGCTTCTTCCTCTGTGTCATGGCTTAT
GATCGGTACCTGGCCATCTGCCACCCACTGCACTATCCCTCCATTATGACTGGCCAGCTC
TGTGGCATCTTGGTGTCTCTTTGTTGGCTCATTGGTTTCCTTGGACATTCAATTTCCATT
TTCTTCATTTTTCAACTACCTTTCTGTGGTCCCAACATCATTGATCATTTTCTGTGTGAT
GTAGACCCACTGATGGCATTGTCCTCTGCCCCTACTCACATCATAGGGCATGTGTTCCAT
TCTGTGAGCTCTCTTTTCATCAACCTCACCATGGTGTACATCCTTGGGTCCTATACCTTG
GTGCTCAGAACTGTGCTTTAGGTTCCTTCTTCAGCTGGATGGCAAAAGGCCATCTCTACC
TGTGGGTCACACTTGGTTGTTGTGTCTCTGTTCTATGGAGCCATAATGCTGATGTATGTG
AGTCCCACACCTGGCAACTCAGTTGCTATGCATAAGCTCATCACACTGATATATTCTGTG
GTAACACCTGTCTTAAACCCCCTCATCTACAGCCTACGCAACAAGGACATGAAATATGCC
CTCCATCATGTCTTCTGTGGAATGAGAATTATCCAGAGATCA

The above sequence is perfect and would have made me super sensitive to smell. However, thanks to gene variations (or more specifically SNPs or CNVs) that came through my mom or dad, my ability to sense smell has gone down. But how?

Diving deeper : From gene sequence to sense of smell 

The next obvious question is “how do you say that the above gene sequence of OR11H7P affects the way we smell”?

As far as any protein/hormone secretion is concerned, it happens in two steps within a human cell. Firstly, transcription causes the gene from inside the nucleus to be encoded on a messenger RNA (mRNA), which is shipped to organelles inside the same cell called ribosomes (which are generally sticking on to another organelle called rough endoplasmic reticulum). The ribosomes are like the binding spots for mRNAs and things called transfer RNAs (tRNAs). tRNAs provide the building blocks for all proteins. As a result of this binding called translation, the gene sequence encoded in mRNA is translated to long polypeptide chains which are in turn sent to another organelle called the Golgi Apparatus which ultimately produces the hormone/protein required for that corresponding part of the body to perform its task. E.g. In case of the sense of smell, the cells are the olfactory cells in our nose and the proteins are called olfactory receptors which do the actual sensing of smell.

Now that we have understood the impact of one gene named OR11H7P on our body, we should also know that the Human Genome Project put the total number of genes to somewhere around 20,000 to 25,000. So imagine how every gene could affect each part of your body. Then, think of the complex machinery and the billions of incredibly coherent and consistent operations happening right now in your body. Isn’t that amazing! Thus the DNA is like the governing body for the human cell. It instructs every cell what to produce, how to produce, when to produce, what to grow, how to grow etc.

For the complete set of human genes to human traits mapping, remember that there are 23 pairs or chromosomes in the human cell and read the compilation at Eupedia. For a more thorough understanding on this subject, read up on Single Nucleotide Polymorphisms (SNP), Copy Number Variations (CNVs) and the Genome Wide Association Studies (GWAS). That should answer the first set of questions we had.

Now that we have a better sense of how exactly we are what we are in terms of size, shape, color, behavior etc. it should be obvious that the evolution is merely selection of better (or more suitable genes) when the offspring is created. One of the major factors that helps evolution lies in a process called meiosis which is responsible for generation of sex cells from oocytes and spermatocytes. There is a particular step called “homologous recombination” after the “crossing-over” step where the parental genes unlink and recombine in various combinations. This means that each sex cell would have a different blueprint of a human being. So we look like what we are right now because of the male sex cell and the female sex cell that combined to create the original zygote. A different combination would have led to a different human being with different selection of traits. As simple as that. Besides this, there is also the effect of human migration across countries and continents on the mix of genetic composition of people in different places. And this answers the second set of questions we had.

Future directions :

Firstly, research. More research.

Interestingly, we might tend to think that all the biological processes could be studied easily by observing every biological process under a super-powerful microscope. But for some reason, it is not that simple. For example, the effect of a protein called dynein on the most fundamental cell division process called mitosis was discovered as recently as February 2012 by Tomomi Kiyomitsu from MIT (reference).  This is 134 years after Walther Fleming originally observed mitosis. Given the nascency of the field of genetics research and the enabling technologies around it, there is no doubt that we have a long way to go in terms of discoveries and products that leverage them.

Secondly, technologies to derive useful inferences from DNA sequences.

We know that the most common type of diabetes, i.e. Type 2 diabetes arises from the fact that human cells cannot respond properly to a pancreatic secretion called insulin. One of the genes that influences Type 2 diabetes is TCF7L2 in chromosome 10 which affects insulin secretion and glucose production. This means that just by looking at our DNA, we can tell if we have a susceptibility to diabetes and similar diseases in future. That exactly is the goal of DNA sequencing. The largest effort on DNA sequencing was the Human Genome Project which ended in 2003 at a cost of $2 billion dollars. Then three startups namely 23AndMe, Navigenics and deCODEme initiated the personal genomics revolution which allowed individuals to get their genome sequenced and helped cut down the cost of DNA sequencing. Besides companies, several individual innovators from legends like Craig Venter to the then 23 year-old student Eugene Chan contributed towards the algorithms and procedures to cut down the cost of DNA sequencing which has ultimately led us to where we are. Once we get our DNA sequenced by any personal genomics company there are services like interpretome.com, that can get those files as input and provide medical inferences which are extremely useful. Our genomes are all set to become yet another major component in our medical records, just like height, weight and blood pressure.

Back in 2008, one of the billionaire entrepreneurs named Sergey Brin (a cofounder of Google) got his DNA sequenced and realized that he had a good chance of being affected by Parkinson’s disease and since then he had started following suitable counter measures for avoiding the same. He had written about this in his blog here.

"This leaves me in a rather unique position. I know early in my life something I am substantially predisposed to. I now have the opportunity to adjust my life to reduce those odds (e.g. there is evidence that exercise may be protective against Parkinson's). I also have the opportunity to perform and support research into this disease long before it may affect me. And, regardless of my own health it can help my family members as well as others.

I feel fortunate to be in this position. Until the fountain of youth is discovered, all of us will have some conditions in our old age only we don't know what they will be. I have a better guess than almost anyone else for what ills may be mine -- and I have decades to prepare for it."

Trivia : One of the cofounders of the personal genomics startup 23AndMe, Anne Wojcicki, was Brin’s wife.

To understand more about the different forces that led to the genomics revolution, I would suggest you to read “The $1000 Genome” by Dr. Kevin Davies. This book beautifully sketches the various people and the companies that initiated this revolution and brought down the cost of sequencing by a huge margin. The cost to get an individual’s genome started from $999 dollars in 2007 to $399 in 2008 to $99 dollars right now (23AndMe). So, get your genome sequenced and know about yourself, literally. I have ordered a kit from 23AndMe and I am super excited about it. A revolution similar to the 1980’s PC revolution has happened silently (atleast to me!) and its high time we embrace this paradigm shift and appreciate its implications to take human civilization to the next level. Also, this is leading us to a whole new era of personalized medicine, where a drug is focused on per disease per person instead of just per disease.

Thanks to my friends at UCSD for inspiring me to read up on biology. Thanks to Hank Green for his wonderful biology lectures. And thanks to all the biologists for providing us better understanding about ourselves every passing day! Keep rocking, folks!

Let me answer the first question that pops up in your head.
Question   : Where the hell have you been the last one year?
Answer     :  I was lost rediscovering myself. Cryptic huh? I can assure you, once you reach the end of this blog post, you will find the meaning to that answer.

From my previous blog posts, you already know that I was an ordinary adolescent ceaselessly rambling about a zillion passions I wished to pursue. Trust me, the uncertainty continues even through my early 20’s. Despite the uncertainty, in due course of time, I have experienced the nature of work in two tech giants of varied origins and goals – Cognizant, a technology services company and eBay, a product company. This blog post summarizes what I have learnt in my brief stint in the corporate world.

Firstly, let me answer the question “Why did I choose eBay?”. To be honest, I did not choose eBay. I was not that laser-focused pro-active hyper-determined foresighted teenager you would find in college. When I sat for the eBay interview, I had absolutely no idea what I wanted to do in my life. My placement officer said its a dream offer. DREAM – that’s the word that pushed me. If getting into eBay is the dream of 500 odd students in my own campus, then its definitely worth a shot. So I attended the recruitment drive and I was in. And I must say that it was one of the best decisions I had taken then.

What followed after getting into the corporate life is what I would like to highlight in this blog post. Just bullet points (Though each point deserves a separate blog post on its own). Here we go.

Lesson 1 : “Its OK” to make mistakes

The initial tasks I was assigned as a fresher were dashboard/reporting tasks – to define in a nutshell, the kind of tasks that won’t bring ebay.com down if I mess up. I totally understood the rationale and I loved the work and learnt a hell lot about web technologies and project management in general. In a few days, I was fortunate enough to lay my hands on some core frameworks in eBay platform. One fine day, my very first change to eBay’s web service framework was about to go live and I made a tweeny blunder in the development to release process. Once I realized it, I was horrified. I thought there will be an outage. Consequently, eBay might lose a good number of customers and I am fired for sure. However, my manager comforted me with the words “Its OK to make mistakes in the initial stages”. That was an invaluable advice that came at the right time. I came back home thinking about it and eventually it seeped in deep into my character. In the days that followed, it helped me to learn things much faster and get myself up to speed with the other developers in my team. With a bit of self-retrospection, it occurred to me that I had feared to make mistakes my entire life. I did not cultivate that much-needed courage. Why? Interestingly, it has its roots in my primary education. I had been a bright student right from my primary school. Whenever I gave an exam, I made sure I don’t make a single mistake. Because, if I do, the chain of events would be like – make mistakes in exam – red ink marks on answer sheet – “You failed to score high marks” – teacher thrashes me – next exam – I don’t want to make mistakes because I don’t to “fail” and get beaten up. And sadly, I have been through this for over 15 years of my school life. So, my brain had taught itself to equate making mistakes to failure and punishment.

Now, I am better. I learnt that asking forgiveness for a mistake is easier and consumes lesser time than asking permission before doing anything new.

Lesson 2 : There is no box!

My team members love having healthy arguments and discussions. The topics ranged from machine learning to the pronunciation of the word “air”. During one of the technical discussions I had with my teammate, he mentioned that my thoughts were outside the box. That was the first time I heard someone use that phrase –  “outside the box”. It directly means ‘thinking from a new perspective’. But I was haunted with a different question – what the hell is this “box” anyway? Why do you visualize “perspectives” to a “box”. After running this question over and over again inside my head, I eventually realized that the box directly meant ossification that happens in the corporate world. You can easily tell engineers apart with reference to this simple criteria – if they are ready to challenge the status quo and innovate, or they just settle with what is just “there and working”.

What creates this difference? As time progresses, whenever we find that a problem is solved with a sub-optimal solution, say X, a few among us ask “why X?”, then, with a few email exchanges, they get the justification on why the solution is sub-optimal and live with it. They forget the next step – asking the question “why not Y?” where Y is the optimum solution. Keeping this mentality of “Why not?” alive will ensure we don’t confine ourselves in this virtual “box” of perspectives. This attitude alone can motivate us to get the big picture and innovate consistently. So we should remember – ask why, at the same time, think why not.

Lesson 3 : Scoping – Breaking a top level idea into achievable chunks, supported by a well-defined timeline

Scoping is one place where I have been failing miserably, but it went unnoticed since most of the tasks in school and college did not expect me to give a timeline for completion. In corporate life, since the projects in my team followed SCRUM model of development, I had numerous opportunities to test myself in scoping. Then, I realized that my timelines for a task X are generally based on two assumptions :

  1. I was the only person alive in office.
  2. X was going to be the only task I was going to work on. There would be no interruptions.

A 5-month experience in SCRUM model helped me to greatly improve upon my scoping skills which is a very important asset to any software engineer. Now, given a task X, I can comfortably break it down into a set of achievable chunks with a clearly defined timeline accommodating all kinds of possible interruptions. If not the best, I can definitely do it much better than what I would have done a year ago.

Lesson 4 : Importance of evaluating myself regularly

It is very important to evaluate ourselves against our end goals, regularly and religiously. In corporate life, in the constant stream of external noise that comes in the form of email, meetings and phone calls, we might end up in a vicious illusion of “important stuff”, clearly losing sight of our goals. We should keep asking ourselves the question “Am I inching towards my end goal with each passing day?” If the answer to this question is “No” for a considerable number of days, then its high time we take a drastic step to reset our priorities and get back on track. For this to happen, its very important that we set up some fixed chunk of time each week, where we go over our long term goals in corporate life and cross-check our current activities with the career trajectory we have projected for ourselves. In my case, I generally go missing from my desk from 3 pm to 4 pm every friday ;) That is my self-evaluation time.  I stuck to the schedule religiously and it really helped me a lot.

I combine this weekly schedule with occasional micro-retirements of 2-3 days. During micro-retirements, I go home, lie on my bed and stare at the ceiling. Nothing else. It helps me to completely stay away from the external noise, allowing my inner voice to take control. Sounds strange and impossible to do. But once you do it, you will like it.

Lesson 5 : Importance and urgency are two different things

While at office, I used to compete with my team lead in literally everything work-related – requirements gathering, planning, scheduling, coding, usage of cutting-edge technologies, execution time, speed in which emails are replied.. well, you name it. Very soon, I realized that I was not as productive as he was. Apparently, I put in an equal effort (often much more) than he does, but still my productivity was no match to what he gets done in the same time. I initially doubted my execution skills, but later understood that the actual problem was in a different phase – Prioritization. It dawned upon me that I was mixing up urgency and importance. Most of the times, tasks come in the form of emails. In that context, when someone starts sending reminders on top of an actionable email, the corresponding task automagically climbs up my priority ladder. So, whenever I get a bunch of actionable emails, I prioritized them according to urgency ALONE, and that was a mistake. As usual, I was experimenting with different ways of prioritizing tasks. On a nice friday morning, I read about the famous Covey’s Time Management Grid. And (many would agree) fridays are the best days for experiments. So i tried it out. The beauty of Covey’s system is that its so simple that I started applying it to my experiments, and found visible results immediately. I am still evolving it to suit my needs. With this, I make sure that I am not just busy, but productive.

Additional point : I combine the time management grid with a rule called the 2-minute rule proposed by David Allen. It says “If you determine an action can be done in two minutes, you actually should do it right then because it’ll take longer to organize it and review it than it would be to actually finish it the first time you notice it.”. It helped me a lot. If you had not tried it earlier, I’d suggest that you give it a shot.

Lesson 6 : Time Management

Firstly, let me talk on buying time. The most lucrative source of time is meetings. Frankly 80% of the meetings can be eliminated by converting them to emails (Yes, I love Pareto’s 80-20 rule). Its true mainly because most of the meetings don’t have a strong discussion point. This leads to discussion on tangential topics without really coming to the problem under investigation.

I was able to convert a few meetings into emails which bought a good amount of time in office. There is a simple communication preference I follow – handle most of the queries through email, next step is phone call, finally resort to setting up meetings. Luckily, I did not have too many meetings. But, as anyone goes up the organizational hierarchy, there will be a need to present oneself and add value in multiple meetings. Having a clear communication preference will help then.

Secondly, its about saving time. I learnt that I work well when I set really hard deadlines to myself. If a task can be completed in 2 hours, I give it no more than 3 hours (including interruptions and coffee breaks). Because, I have a feeling that the task will swell in perceived importance and complexity in relation to the time allotted for its completion. As Parkinson famously stated in a 1955 edition of The Economist, “Work expands so as to fill the time available for its completion”. If we don’t limit it, it will limit our overall productivity and lay its hands on our peaceful work-life balance!

Thats all folks! Having spent an invaluable one year in the industry, I am taking these well learnt lessons to my next step in life – Masters in Computer Science at the University of California, San Diego.

Cheers!

Way to GSoC!

If there is one thing, which is a dream goal for any college student who loves to code, that would be GSoC (pronounced ‘jee-sock’). Well, what is this GSoC? Directly from the horse’s mouth,

Google Summer of Code is a global program that offers post-secondary student developers ages 18 and older stipends to write code for various open source software projects.”

Long story short – Students willing to participate should first go through the list of selected organizations in GSoC -> Choose an organisation -> Choose a project -> Start discussing your proposal with the mentors and improve it -> Make a proposal and submit it through Google Melange. If you are selected, you make history (along with 5000 USDs in your bank account :P).

GSoC 2012

I chose Umit as my organisation. Why? Take a look at their list of projects and you would understand the reason. Among all these projects, the relatively new “OpenMonitor” project was my favourite. I loved their idea. As it sounds, its a Monitor for the Open Internet. It keeps track of all the connections on the Internet and has the ability to trace back the reason of a network blockage or blackout. Simply put, it frames a nervous system of the Internet by implementing a peer-peer topology of nodes scattered around the globe. Thats totally awesome. I really wanted to be part of this wonderful project. When? It was last year (2011) May. I worked with Luis, who is a mentor at Umit. He was really really helpful. He guided me right from scratch and helped me out at every stage. I hacked around a bit on Umit Network Scanner, Packet Manipulator and OpenMonitor then. I even made a talk on Umit Network Scanner at Pycon India 2011.

Then came the news of GSoC 2012. And Umit made its way to the selected organisations list this time too! My joy knew no bounds to know that I had the chance to work on my favourite project as part of the legendary Google Summer of Code :D

I studied the code of Desktop Agent and Mobile Agent of OpenMonitor and I found that the Interpeer Routing was in a prototype-like stage and it really needed to be tweaked up for further enhancements to happen. Thus I started discussing the problem with Zubair, Luis and Adriano and finally settled with implementing a Kademlia based P2P implementation for the inter-peer communication among the desktop agents, mobile agents and the aggregator. We initially planned to make our own implementation from scratch in Python, but later planned to use C++ Kademlia libraries and writing wrappers in Python and Java.

And after all the discussions, I was able to fine tune my project proposal and submit my proposal.

The list of accepted proposals were out by GMT 1900 hours yesterday on the Google melange site and I was glad to see my name on the list. Now, I have a chance to work in one of the coolest projects in the open source world as part of the Google Summer of Code. I am really proud and happy to be at this place.

Special thanks to Dorai Thodla, Karthik Subramaniam, Madhumitha Vishwanathan, Yuvaraj Pandian and all the members of ChennaiGeeks and ILUGC communities in Chennai for exposing me to such excellent opportunities which until last year I hadn’t heard of.

Cheers! :)

This post is about the wonderful experience I had with the Cognizant family in the first edition of “XPERIENCE COGNIZANT”. I wish each one of you experience the same!

So, how to make your way to be part of the 3-day festival? Open up your mind buddy, let me drop in some knowledge ;)

Around the beginning of August 2011, I got the news about the first edition of “Experience Cognizant”. Initially I thought it was an usual mundane meeting wherein people at Cognizant say Cognizant is this and that and show some steeply raising graphs and charts of their profits. (Trust me, it was not so. The experience was OUT OF THE WORLD! )Students who were interested were asked to fill a terse nomination form which had questions like “Name” “Department” etc. and the second half of the page was left blank to fill in any specific achievements we would like to brag about :P After a couple of weeks, we got information through our placement cell that two students were selected as the Cognizant Brand Ambassadors from my college (SSN College of Engineering). Well! It was me and my college senior Nandhitha. Yayy! What next? The only thing we knew was that we should assemble at Cognizant Campus in MEPZ Chennai by 9.00 am on August 26, 2011 and we are gonna stay there for the next three days. Thats it. So I packed up stuff for the next three days and set off for XPC’11

The Cognizant Campus Ambassadors from the select 60 colleges from all over India were invited to participate in the 3-day conclave ‘Xperience Cognizant’. We were around 92 students in total. The purpose of this conclave was to create awareness among the student body about the work ethics of Cognizant and the future of technology as envisioned by Cognizant Technology Solutions. Lets call it a platform provided for the ambassadors to meet and interact with the senior level management at Cognizant and get to know how things work there. It was fantastic to meet the best minds from far corners of India pooled into a single place. We were excited to know what Cognizant had for us for the next three days. Here is a brief note on the 3-day festival.

Day 1:
Satish Jeyaraman who heads Talent Acquisition Team of Human Resource Department gave a presentation on Volatility in the technological world. He was a silent and humble person with versatile knowledge on the corporate world. He explained how Cognizant survived the legendary “Recession” disease. This was followed by a group activity where the ambassadors had to do role-play and collage art work on the topic related to placements. The creativity and acting skills of the students baffled me! There was another session at SIPCOT in Chennai by Ramachandran ,the Head of India for Campus Training Operations, about the training process that takes place at Cognizant. I must say that Cognizant is a mini-college. State-of-the-art technology with brilliant faculty. What else do you need for learning? Btw, it was the end of day. We went back to our rooms in the exquisite FORTUNE hotel standing elegant on the OMR road, Chennai. Owing to the continuous traveling that day, I slept like a baby as soon as I entered the room.

Day 2:
The ex-CEO of Cognizant Mr. Lakshmi Narayanan gave a short presentation and answered all the questions posed to him. I wanted to take a video of his talk. But sticking out my phone amidst such a refined set of audience would make me look dumb #PatheticMe :-P. Then, Raj Bala, Chief Technology Officer of Cognizant took a session on upcoming trends in IT. He also explained about all the research initiatives that Cognizant was pioneering. I was really interested on Cognizant’s work on Cloud Computing and Mobile technologies. Until then I was thinking Cognizant was all about C#, .NET and Java. But I was completely wrong. Their scope is far far beyond what I had initially surmised. Then suddenly we had a quiz competition rolling in! They called it ‘AWE’ General Quiz. Each college forms a team. Nandhitha and I cracked the prelims and won Second Prize in the finals. Then there was a premilinary round on Technical quiz wherein we had questions on C and C++. Being a Computer Science student, I found it really simple and finished it off soon. This was followed with an evening of cultural activities where the employees of Cognizant performed. I even saw few of my college seniors there.

The Day-2 night is unforgettable. Each and every incident which happened then is still so vivid in my head. Now before you jump into conclusions, let me say that your guess is wrong (Bad bad mind, no doughnuts for you! :P) That night, all the Tamil speaking people stayed up in a single room and we were chatting till 3 or 4 in the night (I don’t remember the time. But it was late). We had this “Truth or Dare” game and then some beautiful love stories getting revealed. It was nice meeting new people.

Day 3:
The day began with the Prize distribution ceremony. You have no idea how many prizes Nandhitha and I grabbed then! :D Let me list them.
1. General Quiz: 2nd Place – Won 12.1 MP Sony Cybershot Digicams
2. Technical Quiz: 2nd Place – Won iPods
SSN College emerged as the overall winners and we Campus Ambassadors won Acer Laptops and the title “Grand Brand Ambassadors”. And after that there was no talks, no quizzes or no Cognizantism. It was a special screening of the movie ‘Final Destination 5′ arranged at Mayajaal! It was awesome.

tl;dr : In a nutshell this program was mainly aimed at promoting the brand value of Cognizant so that more students will be interested in being a part of the Cognizant family. It was a wonderful learning-cum-fun experience meeting and sharing ideas with the best brains from across the country. Experience of a lifetime. (And I must say that Cognizant is one of the best workplaces I have seen. If you are a tech news follower, then you’d have noticed that Cognizant CEO D’Souza is one of the titans who’d define India in 2012)

Xperience Cognizant - 2011

And here is the interesting part! Cognizant is collecting nominations for the next version of “Xperience Cognizant”. Contact your college placement cell for more information. All the best guys! Don’t miss it..
Cheers! :)

I just installed Facebook Timeline feature in my profile and got engrossed in it awesomeness. A brilliant feature introduced to the world through the recent F8 Developers Conference, FB Timeline gives a beautiful portrayal of what you are and what you have been. And the timeline is neat and concise with a good mix of statuses, videos and pics, (and most importantly) at an amazing speed! The Timeline feature is the perfect example of gigabytes of per-user information put into good use. Now lets see how to activate it on your profile.

<guarantee>The steps below would hardly take 2 minutes to complete</guarantee>

Step 1 : Open https://developers.facebook.com/apps. This opens the developer page for you account. If you haven’t developed anything yet, it will ask for the “legendary” Request for Permission where we blindly issue an “Allow” irrespective of whatever it asks us to allow :P

Step 2 : Now inside the developer’s page, you could find two obvious buttons to the top right namely “Edit App” and “Create New App”. Click on “Create New app” button.

Step 3 : A new message box appears where we are asked to enter an “App Display Name” and “App Namespace”. I entered it as “Narendran’s Chronicles” since my timeline is just gonna be my own history and the namespace as “narendranapps”. (Never Mind!)

Step 4 : You might have to enter your mobile number of credit card details to make yourself authentic to FB. I used my mobile number. After some 2-3 minutes, got a message saying “Facebook Mobile Confirmation Code: XXXX”. Enter this confirmation code into the textbox that appears on the screen and you are done with this authentication thing.

Step 5 : Now getting into the developer page once again, click on “Open Graph” on the Left bar. Under that choose “Get Started”.

Step 6 : You will get a page “Get Started with Open Graph” and it prompts “Start by defining one action and one object for you app”. I entered “read my timeline” at “profile”, since the timeline gets attached to my profile. Click the green “Get started” button.

Step 7 : The next page gives you options to edit the notifications which are displayed once someone reads your timeline. You can very well ignore this and click “Save Changes and Next”. Else if you are grammatically challenged like me :P you can have your own funny notifications.

Step 8 : Click “Save and Finish” in the next page.

Step 9 : Now you would be facing a page which gives you some alarmingly technical information and makes your mind-voice go WTF! But you could safely ignore this and open your FB profile as usual. You’l get a message which looks like this.

Message regarding Timeline feature


Step 10 : Click “Get it Now”. And yes, you’ve got it now!!

This is how your FB timeline looks!! :)

Cheers! :)

I know that many people are like me – simple wandering about saying “yes” to whatever is asked. Spending most of the time dreaming what to do and suddenly a phone call reminds you that you need to go out to hangout with friends, submit your lab record or attend some meeting/function. In other words, not having a definite goal for yourselves and setting goals based on what you see around at that moment. What you are about to read is one such story – Ya, the story of myself. Read on and you might find a lot of similarities with your own life and that might bring up a smile on your face.

  • In my 10th standard, I wanted to become an archaeologist – I read about the various civilizations and even visited monuments and temples to read history. I talk with Sanskrit professors about the origins of India.
  • Then after seeing a big shot by the name Dr.Kathiravan in my hometown. He was a symbol of dedication, hardwork and passion. Then I wanted to become a doctor and serve the people.
  • I was naturally good at drawing (thanks to mom). I attended some painting classes during my 11th standard under Mr.Sylvester Peter. He used to say me that I have natural talent and could become a very good artist one day. Coincidentally I was already winning prizes at state level competitions. So, (you know a school boy’s mindset rite?)  I wanted to become a professional artist.
  • My father is a coach in my district cricket association. He taught me every nuance in fast bowling and made me a pretty good bowler. When I made it into the district team, I thought I should enter into the Indian cricket team one day.
  • When I reached the later part of 11th standard, I loved every concept in Physics and made a prototype of a Reverse Osmosis plant with my classmates. I was inspired by Albert Einstein, the man synonymous with the word “Genius”. I wanted to revolutionize the world by inventing the Time machine :P
  • During my 12th standard, I wanted to be a polymath and started winning every extra-curricular activity I found in my way. My dream of getting state rank perished with that. But I was very, very happy travelling long distances and meeting new people.
  • The 12th annual holidays helped me get into better contact with my brother Vivek. My brother has been winning the best employee award every Q (Quarter of a financial year) ever since he entered into Robert Bosch. He is the youngest person to get an onsite job in the HQ of Bosch in Germany. Seeing him grow, I wanted to become a Mechanical Engineer.
  • Then since I was engrossed in Computer Games during the 12th holidays, my parents said that I might be naturally inclined to computers and enrolled me for BE Computer Science under Anna University, Chennai. And yeah, I did learn it with passion (like I did for every other activity :D)
  • I started learning Java in my first year under one of the Assistant Professors in my department. I made a calculator using Java Swing and said to myself that “Yeah! thats it man! I am the king of Java. I will learn all the packages within a month and create a really big project in it. Thus I can get into Sun Microsystems as a Java specialist”. (Naivety ruled me :D)
  • Then came the voices on Cloud Computing. I started working on Xen, read lots of Amazon white papers and made some *trivial* papers on Cloud Computing. I was working all alone then.
  • Then one celestial meeting occurred, I met my best friend Ahamed Nafeez in my own hostel. He too seemed to be in a similar wavelength as myself. When I talked with him, before I could realise we were best friends already. We decided to work in Networks. We did certifications togethers, won Network engineering competitions, paper presentations, and to cap it all, we did a workshop on Network security. During those days, my dream company was Cisco and Cisco only.
  • Then when I saw Android flourishing, I started hacking into android development. I was jaw-dropped on seeing the cool projects in the Android Developer Conference. I worked with my roommate Ganesh to create some cool projects involving a variety of Android technologies. We wanted to make a startup on Android Apps.
  • Then I got introduced to the Bhumi Social Foundation through Manoj. At this point, you should know that my entire family is known for social service. Even I got some accolades regarding that. So I was easily influenced and I got into that completely different world. Then I decided to  get into full time social service by becoming a member of Teach For India. I have already said about the phone interview I had. But with a second thought, full time social service did not look like a good idea. So I dropped it.
  • Then I got my first Wifi enabled phone Nokia E63. I used Internet in my mobile very often. When I found that browsing was too slow in wireless networks, I started working on a solution and found a problem with TCP performance.  I made a research paper on it and it will published as a proceeding in Springer LNCS in few days. I wanted to bring a change in the way Wireless Networks worked.
  • Then my interest in Python began to sprout out when GSoC 2011 approached. Though I couldn’t do GSoC this year due to my brother’s marriage, I got into another Summer of Code by Umit, which was also a part of GSoC. Then I started making a few hacks in Python and now am sitting at PyCon in Pune typing out this blog at an alarming speed :P Now I dream of becoming an expert python hacker. :D

To finish it off, I realize that what I am now is just the remnant of all the previous Narendrans I had been throughout my life. Sorta jack of all trades. Seeing the specialist Python Hackers around me makes me feel guilty of not having done anything significant. I have tried atleast a 100 different things in the past six years that went undocumented and unnoticed :P. Saying this, even my future is uncertain. Few years down the lane, I have no idea what I would be doing. I don’t even know if this is strange or this is a “Typical Adolescent Thinking”. I need to specialize in one field through which I can effectively serve the community. DOT.

When I was hopelessly lamenting this to my mom, she replied, “What is the highest position in your field? Something named Google rite? I don’t want you to get in there and break your head. You got placed already. Be happy for that. Oor suthify with your friends, get married in a couple of years, settle happily and speak Tamil at home. Thats enuf. And dont ever take this topic again when on phone or when at home!!”

In a nutshell : I say “Enna valka da idhu”, Mom says “Keep it simple silly!” :D

Though I have loads of things to blog about, am settling down with the life lessons I have learnt through my varied experiences as a son, brother, friend, student, painter, gamer, social servant, hacker, team leader and an insane thinker. The final result I got after brainstorming myself is something that is better felt than being listened to. Here is the depiction of what I figured out from my little 20-year experience.

Lesson 1 :
You can become whatever you wish to become with sheer dedication and hardwork. Be it a doctor, computer engineer, scientist, painter, musician, Anna Hazare, or Osama Bin Laden, you name it! But what matters is what you love to do.. What you are made for.. What every cell of yours is inclined to do.. What is it that you can do 24x7x365 tirelessly with complete passion. That is your destiny. Don’t waste your life trying to become someone else. Life is counted on how much you have enjoyed by being yourself.  Don’t hide your true potential just because you feel that its not upto the mark. You are already awesome :)

The obvious question is “How do we find what we are made for?”. Answer – No one else other than you could find it. Ask yourself and get confused a million times, you will find the right answer one day.

Lesson 2 :
My life in Chennai taught me a hell lot about relationships. Ofcourse, am learning some hard lessons even now. But one fundamental concept I noticed is that – Many people in Chennai are NOT what they seem to be. They pretend to be that “someone else” for the sake of getting accepted by the society. And thats hilarious. When you are true to yourself and to the community around you, whatever you get would be a genuine fit for you. Even if you have very few friends, you could be 100% sure that they are true to you.

In short – Don’t waste your life trying to become something. Do what you love to do, and automagically you will become the one you are destined to be. A fantastic life is guaranteed if you start living YOUR life right now and enjoy every moment.

You might think that these are the words which you find on some lame books like “You can Win” or some Share-Auto’s cover. But trust me.. This is the Ultimate Truth.

Still I have lot more to say, but for now its better if I halt with this :P

Courtesy – The innumerable times I’ve spent time thinking about human life and to my role model who has been my inspiration since birth, my lovely lovely brother Vivek Thangarajan.

Cheers! :)

I’ve been wanting to share this for quite long. Am extremely happy to say that I got placed (along with @madhuvishy @TheAkj and Divya) in the reputed eBay-PayPal for a pretty decent compensation package. :) So here is the story how I made it.

eBay - Paypal

eBay-PayPal is the first company that came for recruitment in my college. So almost everyone of us was really excited about how the interview process is gonna be. We discussed a lot among ourselves about how the questions might be and had a good laugh over some really funny arguments. Pure #Naivety :P

Initially the eligibility criteria for attending the recruitment process was 90% in 10th, 12th and in college without standing arrears!! Manasatchilessly daunting, isn’t it? I see that you couldn’t help yourself from avoiding that jaw-dropping expression adorning your visage. That’s how we stared at our Placement Officer when he announced it. When he found that only one person was eligible from the whole college, he relaxed one of the constraints. From 90%, the cutoff dropped to 75% till 6th semester in college. Yet the 90% in 10th and 12th remained. I WAS IN!

The recruitment process started on August 1st (My  Birthday :) ) The first round was a written test. The “legen-dary” Multiple Choice Questions. We had 30 questions out of which (to our surprise) about 60% was based on Java and C++, while the rest of the questions spanned around verbal and quantitative abilities. To be more specific, here are a few niches you could focus on..

  • OOPS concepts – Data abstraction, Excapsulation, Virtual Destructors etc.
  • Database – SQL Queries and the basics
  • Networks – Subnet addressing
  • Probability – coupled with Permutation/Combinations
  • Analogies

We were given the question paper, an OMR sheet and 45 minutes to crack the questions. To be frank, the questions were easy and I was wondering how the eBay recruitment team is gonna choose from the competitive scores. But after half an hour, a set of 22 students were shortlisted from the talented lot. And I was one among them :) That marked the end of the day.

The next day we had a series of Technical Interviews. The interviewers tested our knowledge on pattern matching, logical thinking, problem solving skills, Java, DBMS and Data Structures. And regarding Java, most of the questions were from java.util.Collections Framework. Poor me! Having no idea about this one topic, I was struggling with the Java questions. I m pretty good with the DBMS concepts, so that overshadowed my “Java Deficiency Syndrome”. And all thanks to my considerably strong resume. And I hold an 8.6 CGPA – neither too good nor too bad. So I had my resume as the trumpcard. Since I had two really good projects on DBMS and Java, one submitted to IBM and the other which fetched me a 30k bounty at the National Level Database Design Competition at IIT-K, I was confident. Another challenge I faced there during the interview was that I was more of a computer networks guy than a hardcore programmer, yet I had to project myself as a software developer there.

In my case, the third round of Technical Interview was skipped. And finally, by the end of the day, they read out five names including mine. I thought that it was done and I was in! But then dawned the ultimate twist. The HR interviewer Ms.Kalaivani said, “You guys are shortlisted for the final round, which will be held at eBay office tomorrow”. On hearing that the inner voices of all five of us resonated “OMG! Not AGAIN!!”. Of course, everything is for getting into a good company.

The next day, a gorgeous Innova drew up near my hostel gate at around 1 pm. I was comfortably escorted to eBay office where I met my four colleagues. The workplace was cool (pun -the A/C :P). The employees there dint seem tensed at all. So I was really motivated to get such a tension-free yet high-paying job offer.

There we went through two more rounds of technical interview. This time it was us who did the talking. In my case, the interviewers were keenly interested in knowing about every line in my resume. Thus it was almost a cake walk for me then.  The final round was a HR interview with the mundane “Tell about yourself” and “What your strengths and weaknesses”. After everything was done, the same Innova car ensconced me back to my hostel. Thus ended the awesome experience!! And the very same night, we got the results from the eBay office. Thus after a written aptitude test, four rounds of Technical Interview and an HR Interview, I WAS SELECTED!!  So this is where I would find myself in a few months..

eBay-PayPal Office in Chennai

Thus happily everafter :) Cheers!

Web has become almost ubiquitous with our daily chores.  Take for example – When we sit before our PC/Laptop, how many of us start typing the letters “F” “A” “C” and choose “facebook.com” from the drop down and then wonder why we chose it? Such is the impact of the Web on our routine activities. Research says Internet has changed the way we remember facts. Rather than remembering the birthdate of our best friends, we just rely on Gmail reminders. Don’t we?

The amount of information generated in the World Wide Web each day is unimaginably high. What could be done in 60 seconds? Sounds trivial? Well, let me allow the picture to speak for itself.

The Web in 60 seconds

This mammoth network of networks wasn’t built in a day. The web has seen a phenomenal growth since its inception.

Web 1.0 – The Read web. People could just read the contents articulated by others. One-way communication.

Web 2.0 – The Read, Write Web. People could comment on what others said. Thus started the era of blogging. Two-way communication.

Web 3.0 – The Read, Write, Execute Web. People share their ideas. And the system processes and understands the information it has obtained from various authors and suggests the contents which a particular person would be interested in. That’s why he call it the Semantic Web. Suggestion Engines, Mashups, Micro-blogging etc. make the Web much more interactive.

Now we are experiencing the indocile rise of HTML5, which, I feel, is a paradigm shift in Web technologies. With a clever use of HTML5, JavaScript and CSS almost anything and everything could be emulated on the Web. And the OS makers are also ceaselessly working to avoid being an #epicfail. Say, with Windows 8, all the applications (called tailored apps) are supposed to run on HTML5, bringing in in a radically new concept for an operating system. And we are expecting a ChromeOS which could sound the death-knell to all the Native Apps and introduce the concept of “Browser is the OS”.

The Internet we are witnessing now is something larger than life. Something we are depending on so heavily that one day we might even forget our own names and check our Google+ profiles to get them.

The future of Internet, I believe, would be to make an unified ecosystem wherein it would be possible to get the same amount of data storage and processing power from any kind of device connected to the internet. 

Below is a wonderful infographic on how far the Internet has catapulted from humble beginnings to colossal heights.

Extent of "Internetization" : Courtesy - Cisco

<Note> Absolutely No Statistics. Purely Experience </Note>

Well, its counseling time in Tamil Nadu and the students are already super perplexed on which college to choose. There are generally two ways students choose their college.

1. Best College — Whatever Department is available

2. Favourite Department — Whatever College is available.

I would flatly say them to choose their favourite department in any college in a CITY for various reasons. Though the word CITY seems general, I infer the following from my migration from Sivakasi to Chennai. To list a few of the merits..

Being in the city, you could get along with a good mixture of people from all corners of India. Mingling with them will often mandate the use of English. Thus you need not attend any spoken English classes for bettering your communication skills. Getting embarrassed a couple of times is the fastest way to develop your English knowledge. ;) By the time placements are on, you are already an eloquent and attractive speaker.

In terms of technology, cities are (on an average) two years faster than other towns and villages in India. Well, its obvious. Since the city side students are exposed to such knowledge right from their birth, they are undeniably a step ahead of other students from villages. Thus getting in touch with them would help you learn and grow faster. And within a year you could find yourselves standing on par with them in every aspect of life. And remember, its not about competing with them, its about growing together. Many don’t understand this and fall into a conundrum.

City is the place where the things are happening for real. Like there is difference between reading about a Grand Startup Fest in a newspaper and being a part of that Grand Startup Fest itself. So being in the city offers you the chance to participate in many organisations which hitherto had been only in your monthly digests/newspapers.

The best coaching centres for GRE/CAT/GATE/You-name-it is present in the City. In Chennai, there are Time, Kaplan, Career Launcher, IMS etc. Numerous students get into top-notch universities through such coaching. And this is a major advantage.

About the culture. As with the variety in languages, you could enjoy a variety of cultures and mannerisms. It is a little hard to be yourselves when people around you sport enticing gears and cinematic lifestyles. But that is left to you.

Now getting down to the Computer Science stream, I would easily say that am enjoying a lot more features than any student in any other part of TamilNadu, just because I am in Chennai. The number of technology communities in Chennai is remarkably high that its tough to choose where you want to be. And each community is flourishing at a blistering pace. For the list of groups in Chennai you can refer to the list made by Kevin William David – http://blog.kevinwilliamdavid.me/2011/06/05/list-of-startup-tech-groups-in-chennai/

There are meetings from the Chennai’s Linux User Group where open source enthusiasts share knowledge by taking seminars on various topics. Then there is this Nerd Dinner wherein you could meet the nerds from all over Chennai and have dinner with them. Then there is the Python Group, Android Group, and loads of startup groups which guide you with your entrepreneurial skills. Thus you are never alone. You always have an excellent team working with you.

Though there are a few negative points, like the other side of the coin, I don’t think it would overshadow the merits of being in a college in city.

So thats it.. Just wanted to share this opinion.

Cheers :)

Follow

Get every new post delivered to your Inbox.

Join 1,418 other followers